##gff-version 2 ##date 2003-02-20 ##sequence-region CHROMOSOME_III 1 13783268 CHROMOSOME_III assembly_tag Finished 1265315 1265318 . - . Note "Left: ZC47" CHROMOSOME_III assembly_tag Clone 1265418 1265423 . + . Note "right end: Y119D3" CHROMOSOME_III assembly_tag annotation 1283799 1283802 . - . Note "not sure if this is TTGG or TTTG" CHROMOSOME_III assembly_tag Finished 1291656 1291661 . - . Note "Right: ZC47" CHROMOSOME_III assembly_tag Clone 1291656 1291661 . - . Note "right end: ZC47" CHROMOSOME_III assembly_tag final 3339157 3339160 . + . Note "annotation: beginning of F45H7" CHROMOSOME_III assembly_tag final 3361251 3361255 . + . Note "annotation: probable beginning of C56G7" CHROMOSOME_III assembly_tag annotation 3378432 3378435 . + . Note "C56G7 JUST ITS FINISHING" CHROMOSOME_III assembly_tag final 3378432 3378435 . + . Note "annotation: end of F45H7" CHROMOSOME_III assembly_tag annotation 3378432 3378435 . + . Note "THIS IS NOT THE BEGINNING OF " CHROMOSOME_III assembly_tag annotation 3378432 3378435 . + . Note "end of F45H7 start of C56G7" CHROMOSOME_III assembly_tag annotation 3378432 3378435 . + . Note "start of C56G7" CHROMOSOME_III assembly_tag annotation 3378432 3378435 . + . Note "TRUE START ON F45H7" CHROMOSOME_III assembly_tag annotation 3378904 3378919 . + . Note "number of T's not 100% certain but spacing suggests 6." CHROMOSOME_III assembly_tag annotation 3385024 3385034 . + . Note "Problem repeat area between 620 and 8850 21 copies of a 95bp repeat element. where data is weak, the sequence has been edited with the help of the repeatconsensus. The assembly is correct according to differences between individual copies of the repeat. The total size of repeat agrees with pcr from cosmid and genomic DNA So, to the best of our knowledge this is correct, but beware!" CHROMOSOME_III assembly_tag annotation 3385067 3385068 . + . Note "point mutation of T to C at this point on single strand only." CHROMOSOME_III assembly_tag annotation 3385108 3385121 . + . Note "Compression resolved only on negative strand other versions read GAGGGCC" CHROMOSOME_III assembly_tag annotation 3385203 3385214 . + . Note "Compression resolved on one strand only" CHROMOSOME_III assembly_tag annotation 3385221 3385223 . + . Note "Majority of reads are CAC with a single read ambigous" CHROMOSOME_III assembly_tag annotation 3385250 3385250 . + . Note "could well be T, go with the consensus" CHROMOSOME_III assembly_tag annotation 3385262 3385262 . + . Note "edit to consensus" CHROMOSOME_III assembly_tag annotation 3385291 3385317 . + . Note "compression resolved on one strand only" CHROMOSOME_III assembly_tag annotation 3385389 3385414 . + . Note "compression resolved on one strand only" CHROMOSOME_III assembly_tag annotation 3385486 3385501 . + . Note "Hairpin GGGCC-loop-GGCCC loop is probably GCA but resolution may not be complete despit the terminator" CHROMOSOME_III assembly_tag annotation 3385581 3385599 . + . Note "Difficult hairpin repeat Sequence uncertain" CHROMOSOME_III assembly_tag annotation 3385643 3385644 . + . Note "Ambigous base but repeat consenus suggests an A" CHROMOSOME_III assembly_tag annotation 3385667 3385669 . + . Note "variable region in the repeat may be either T or C" CHROMOSOME_III assembly_tag annotation 3385680 3385688 . + . Note "only postive strand but consensus agrees with previous copies" CHROMOSOME_III assembly_tag annotation 3385689 3385696 . + . Note "consensus as per normal copy but unresolved in this region " CHROMOSOME_III assembly_tag annotation 3385764 3385768 . + . Note "so0f8 repeat reads give AAG but original read and s13d11 give AGG." CHROMOSOME_III assembly_tag annotation 3385779 3385793 . + . Note "Compression edited according to repeat concensus TAC (instead of CAC) is a variation in this copy of the repeat." CHROMOSOME_III assembly_tag annotation 3385842 3385845 . + . Note "original read clearly shows CGC which is in agreement with the repeat consensus terminator read shows CGG. " CHROMOSOME_III assembly_tag annotation 3386513 3386519 . + . Note "edited GCCTAC according to consensus" CHROMOSOME_III assembly_tag annotation 3386751 3386758 . + . Note "probably CTAA" CHROMOSOME_III assembly_tag annotation 3386917 3386960 . + . Note "single stranded region with terminator across it" CHROMOSOME_III assembly_tag annotation 3386925 3386934 . + . Note "end of problem repeat region" CHROMOSOME_III assembly_tag annotation 3387041 3387041 . + . Note "very difficult compression probably a C" CHROMOSOME_III assembly_tag annotation 3390417 3390417 . + . Note "uncertain base, probably an A" CHROMOSOME_III assembly_tag annotation 3390472 3390548 . + . Note "singlr stranded region" CHROMOSOME_III assembly_tag annotation 3390612 3390689 . + . CHROMOSOME_III assembly_tag annotation 3390689 3390765 . + . Note "single stranded region with terminators across" CHROMOSOME_III assembly_tag annotation 3390765 3390774 . + . CHROMOSOME_III assembly_tag annotation 3390958 3390958 . + . Note "pcr mutation T > c" CHROMOSOME_III assembly_tag annotation 3391307 3391324 . + . Note "Single stranded region with terminator across" CHROMOSOME_III assembly_tag annotation 3391324 3391463 . + . Note "Single stranded with terminator acroos region" CHROMOSOME_III assembly_tag annotation 3391601 3391607 . + . Note "number of A's varies between 6 and 7" CHROMOSOME_III assembly_tag annotation 3391640 3391641 . - . Note "Two traces show PCR point mutation of T to C tewlve reads show clear T" CHROMOSOME_III assembly_tag annotation 3391641 3391641 . + . Note "2/12 T to C" CHROMOSOME_III assembly_tag annotation 3392097 3392200 . + . Note "Single stranded with terminator across the region" CHROMOSOME_III assembly_tag comment 3393360 3393360 . + . Note "Begining of F59A2" CHROMOSOME_III assembly_tag repeat 3408565 3408578 . + . Note "Possible repeat for 300 bases - matches 215 889 " CHROMOSOME_III assembly_tag annotation 3411109 3411111 . + . Note "All positive and negative standard reads show three G's, as do positive terminators. Negative terminator on one read shows GAG." CHROMOSOME_III assembly_tag repeat 3412216 3412348 . + . Note "repeat unit 1" CHROMOSOME_III assembly_tag repeat 3412249 3412250 . - . CHROMOSOME_III assembly_tag repeat 3413340 3413398 . + . CHROMOSOME_III assembly_tag repeat 3413398 3413472 . + . Note "repeat unit 1" CHROMOSOME_III assembly_tag annotation 3418631 3418634 . + . Note "Beginning of K01A11" CHROMOSOME_III assembly_tag annotation 3420455 3420622 . + . Note "single-stranded with terms to check" CHROMOSOME_III assembly_tag annotation 3428455 3428554 . + . Note "Single-stranded with terms" CHROMOSOME_III assembly_tag annotation 3428555 3428692 . + . Note "Single-stranded with terms" CHROMOSOME_III assembly_tag annotation 3428693 3428866 . + . Note "Single-stranded with terms" CHROMOSOME_III assembly_tag annotation 3429815 3429818 . + . Note "right end of F59A2" CHROMOSOME_III assembly_tag annotation 3430900 3430900 . + . Note "Extra g in this sequence s28d1.s1l" CHROMOSOME_III assembly_tag annotation 3433663 3433667 . + . Note "deleted clone" CHROMOSOME_III assembly_tag annotation 3433690 3433694 . + . Note "unclear part of hairpin inverted repeat, probably 5 g's, matches 5Cs at other end of inverted repeat " CHROMOSOME_III assembly_tag annotation 3433791 3433792 . - . Note "part of inverted repeat probably a C but data is weak." CHROMOSOME_III assembly_tag annotation 3433806 3433810 . + . Note "unclear region of hairpin inverted repeat, edited to 5 c's pairs with 5gs at other end of hairpin " CHROMOSOME_III assembly_tag annotation 3442785 3442786 . + . Note "pt mutation on single read" CHROMOSOME_III assembly_tag annotation 3443616 3443616 . + . Note "Majority of reads (including terminators) read G single read gives an A here" CHROMOSOME_III assembly_tag annotation 3445031 3445031 . + . Note "marker point 1 " CHROMOSOME_III assembly_tag annotation 3445379 3445385 . + . Note "false join between 2 contigs containing repetitive sequence Distance between marker point 1 (26400) and marker point 2 (28360) should be 2.2kb according to restriction digest and pcr data. This suggests a gap of about 200bp at this point. before this point we have 2 full copies of a 120bp repeat element, with a third copy beginning This element has some homology to RcA1 The 2nd contig joins in from the beginning of this tag and contains a further 3 copies of the 120bp motif The gap probably holds 2 copies of this element, which would suggest a total of 6 copies There are then 52 copies of an 11bp motif beginning at 27350 Because of the repetitive nature of this region, some of the bases between the 2 marker points may be ambiguous. Where no base can be called, an n has been left No further work is planned on this gap" CHROMOSOME_III assembly_tag annotation 3445554 3445564 . + . Note "read may be mis-assembled" CHROMOSOME_III assembly_tag annotation 3446987 3446987 . + . Note "marker point 2" CHROMOSOME_III assembly_tag annotation 3451338 3451349 . + . Note "50 base-pair rule used here. " CHROMOSOME_III assembly_tag annotation 3452171 3452174 . + . Note "left end of C34C12" CHROMOSOME_III assembly_tag annotation 3452171 3452175 . + . Note "Begining of overlap with C34C12" CHROMOSOME_III assembly_tag annotation 3459605 3459608 . + . Note "end of K01A11" CHROMOSOME_III assembly_tag annotation 3463808 3463818 . + . Note "10 T's -best guess (could be 9-12) " CHROMOSOME_III assembly_tag annotation 3466995 3467203 . + . Note "single stranded with terminators" CHROMOSOME_III assembly_tag annotation 3467204 3467421 . + . Note "single stranded with terminators" CHROMOSOME_III assembly_tag annotation 3468069 3468089 . + . Note "single stranded with terminators" CHROMOSOME_III assembly_tag annotation 3468384 3468438 . + . Note "single stranded with terminators" CHROMOSOME_III assembly_tag annotation 3468476 3468476 . + . Note "unable to call this base terminators etc. tried." CHROMOSOME_III assembly_tag annotation 3486826 3486829 . + . Note "beginning of M01F1" CHROMOSOME_III assembly_tag annotation 3486826 3486830 . + . Note "Beginning of M01F1 @ position 9 Overlapping with C34C12" CHROMOSOME_III assembly_tag annotation 3535572 3535685 . + . Note "region covered by a single read only terms and primers. All pcrs across region failed. This single read was found by screening Phagemid libraries and was the only real clone recovered" CHROMOSOME_III assembly_tag annotation 3536552 3536552 . + . Note "T has high G background on most reads but the evidence suggests the T is real" CHROMOSOME_III assembly_tag annotation 3536673 3536674 . + . Note "edited to GG. S1 reads show clear GG, but terminators call GGG. Terms do however have the spacing of 2 Gs, and none of them show 3 clear peaks, so the evidence suggests GG" CHROMOSOME_III assembly_tag annotation 3536939 3536941 . + . Note "edited to 3Cs, primer and terminator data agree with this. 2 terminator walks have the spacing of 4 Cs, but both were run on the same gel, suggesting a gel artifact." CHROMOSOME_III assembly_tag annotation 3558475 3558481 . + . Note "Start of C48D5" CHROMOSOME_III assembly_tag annotation 3565294 3565297 . + . Note "End of C54C6" CHROMOSOME_III assembly_tag annotation 3566749 3566890 . + . Note "ss with term, coming out of difficult repeat region, unable to get negative reads to work" CHROMOSOME_III assembly_tag annotation 3566820 3566820 . + . Note "Data a little messy, but this base is most probably an A." CHROMOSOME_III assembly_tag annotation 3570381 3570387 . + . Note "CTTC - Data indicates probably a T but is a bit stoppy, even with terminators." CHROMOSOME_III assembly_tag annotation 3591848 3591872 . + . Note "s84h9.s2t goes into vector just 26 bases short of area which is double stranded. Hence used the 50 b.p. rule and just put terminator, s86g4.s1t, across." CHROMOSOME_III assembly_tag annotation 3596741 3596745 . + . Note "Start of C32A3" CHROMOSOME_III assembly_tag annotation 3596743 3596746 . + . Note "beginning of C32A3" CHROMOSOME_III assembly_tag annotation 3600813 3600816 . + . Note "end of C48D5" CHROMOSOME_III assembly_tag annotation 3611230 3611276 . + . Note "doulbe-stranding failed with 4 different oligos. I have put a terminator across the other strand to check for compressions" CHROMOSOME_III assembly_tag annotation 3611327 3611340 . + . Note "sequence messy due to run of Cs, but probably correct" CHROMOSOME_III assembly_tag annotation 3611343 3611363 . + . Note "run of Gs, not double-sranded all the way aross. Number of Gs defined by Sequenase run terminators run on either side up to run of Gs" CHROMOSOME_III assembly_tag annotation 3611379 3611475 . + . Note "region to right of Gs single-stranded only, but covered with terminators, so no suspected compressions have been found" CHROMOSOME_III assembly_tag annotation 3612816 3612836 . + . Note "number of Gs unsure" CHROMOSOME_III assembly_tag annotation 3612839 3612860 . + . Note "negative strand only, but terminated to check against compressions" CHROMOSOME_III assembly_tag annotation 3615996 3615996 . + . Note "terminators on both strnds say 2 clear Cs non terminator reads call a T, but are less clear. I think CC is correct" CHROMOSOME_III assembly_tag annotation 3616537 3616537 . + . Note "point mutation of A to T on single read" CHROMOSOME_III assembly_tag annotation 3618791 3618816 . + . Note "not double-stranded through run of Cs, but terminators run to check for compressions" CHROMOSOME_III assembly_tag annotation 3624211 3624218 . + . Note "one read has this sequence deleted, It is present in all other + and - reads." CHROMOSOME_III assembly_tag annotation 3629117 3629140 . + . Note "single-stranded, but with a terminator to confirm" CHROMOSOME_III assembly_tag annotation 3632323 3632354 . + . Note "single-stranded, with terminators to solve potential compressions" CHROMOSOME_III assembly_tag annotation 3637155 3637155 . + . Note "single read has point mutation of G to T" CHROMOSOME_III assembly_tag annotation 3641896 3641902 . + . Note "?difficult region from pcrs used 'best guess' sequence" CHROMOSOME_III assembly_tag annotation 3641896 3642145 . + . Note "single-stranded" CHROMOSOME_III assembly_tag annotation 3641899 3641899 . + . Note "T > A MUTATION IN PCR FRAGMENT" CHROMOSOME_III assembly_tag annotation 3642147 3642151 . + . Note "sequence from pcr fragment. Not 100% certain over these 5 bases used best call of terminators" CHROMOSOME_III assembly_tag Finished 3642151 3642151 . + . Note "Left: " CHROMOSOME_III assembly_tag annotation 3642151 3642154 . + . Note "beginning of C46f11" CHROMOSOME_III assembly_tag Clone 3642151 3642154 . + . Note "left end: C46F11" CHROMOSOME_III assembly_tag annotation 3662682 3662682 . + . Note "dificult region where cosmid pcrs have failed. Data suggests an A, but background is high so there is some doubt" CHROMOSOME_III assembly_tag annotation 3666504 3666522 . + . Note "region that follows, represents 7 copies of a 65bp tandem repeat consensus ATTATTTTTATTCGTCTTATAATTTTAGAAAATTTTCAATAAAAATTTAAGACACTAATAAAAT We were unable to join this using just sequence data alone, and suggest this is due to variation in the consensus sequence within different clones. A phenomenon also seen in pcr across the region. Restrition digest data suggests a 3.2 bp band between 2 flanking StuI sites, so the 2 contigs have been joined and the data edited to a consensus over this region." CHROMOSOME_III assembly_tag annotation 3666888 3666888 . + . Note "probablyA part of tandem repeat" CHROMOSOME_III assembly_tag Clone 3667692 3667695 . + . Note "left end: T27D1" CHROMOSOME_III assembly_tag Finished 3667796 3667796 . + . Note "Right: " CHROMOSOME_III assembly_tag annotation 3676890 3676893 . + . Note "Beginning of T27D1 edit @ position 14774. End of C46F11 edit. End of C46F11 @ postion 22947. " CHROMOSOME_III assembly_tag annotation 3676890 3676893 . + . Note "Beginning of T27D1 edit. " CHROMOSOME_III assembly_tag annotation 3679990 3679990 . + . Note "Point mutation on single PCR clone. A changed to a G" CHROMOSOME_III assembly_tag annotation 3679997 3679997 . + . Note "Point mutation on single PCR clone. T changed to C" CHROMOSOME_III assembly_tag annotation 3680035 3680035 . + . Note "Point mutation on a single PCR clone. T changed to a G " CHROMOSOME_III assembly_tag annotation 3680078 3680078 . + . Note "Point mutation on a single PCR clone. A changed to a T" CHROMOSOME_III assembly_tag annotation 3680086 3680086 . + . Note "Point muation on a single PCR clone. G changed to an A" CHROMOSOME_III assembly_tag annotation 3680168 3680169 . - . Note "Single PCR clone has ten T's. Consesus has nine " CHROMOSOME_III assembly_tag annotation 3680168 3680169 . - . Note "Single PCR clone has ten T's. Consensus has nine T's." CHROMOSOME_III assembly_tag annotation 3680169 3680169 . + . Note "Single PCR clone has ten T's. The consensus has nine T's." CHROMOSOME_III assembly_tag annotation 3680170 3680170 . + . Note "Point mutation on a single PCR clone. T changed to an A" CHROMOSOME_III assembly_tag annotation 3680240 3680240 . + . Note "Point mutation on a single PCR clone. A changed to G" CHROMOSOME_III assembly_tag annotation 3680247 3680247 . + . Note "Point muation on asingle PCR clone. G changed to an A" CHROMOSOME_III assembly_tag annotation 3680299 3680299 . + . Note "Point mutation on a single PCR clone. T changed to a G" CHROMOSOME_III assembly_tag annotation 3680328 3680328 . + . Note "Point muation on a single PCR clone T changed to an A" CHROMOSOME_III assembly_tag annotation 3680336 3680336 . + . Note "Point muation on a single PCR clone T changed to a C" CHROMOSOME_III assembly_tag annotation 3680358 3680358 . + . Note "Single PCR clone has eight A's. The consensus has seven A's." CHROMOSOME_III assembly_tag annotation 3680373 3680373 . + . Note "Point mutation on a single PCR clone A changed to G" CHROMOSOME_III assembly_tag annotation 3680380 3680380 . + . Note "Point mutation on single PCR clone A changed to a G" CHROMOSOME_III assembly_tag annotation 3680412 3680412 . + . Note "point mutation on single PCR clone T changed to C" CHROMOSOME_III assembly_tag annotation 3680454 3680454 . + . Note "Point mutation on single PCR clone T changed to C " CHROMOSOME_III assembly_tag annotation 3680492 3680492 . + . Note "Point mutatiopn on a single PCR clone. A changed to a G." CHROMOSOME_III assembly_tag annotation 3680494 3680494 . + . Note "Point mutation on a single PCR clone. A changed to a T" CHROMOSOME_III assembly_tag annotation 3680687 3680687 . + . Note "point mutation on a single PCR clone. G changed to an A." CHROMOSOME_III assembly_tag annotation 3680690 3680690 . + . Note "Point mutation on a single PCR clone. T changed to a C" CHROMOSOME_III assembly_tag annotation 3680786 3680786 . + . Note "Point mutation on PCR clone T changed to a C" CHROMOSOME_III assembly_tag annotation 3680796 3680796 . + . Note "Point mutation on single PCR clone. T changed to an A" CHROMOSOME_III assembly_tag annotation 3680831 3680831 . + . Note "Point mutation on single PCR clone A changed to a G" CHROMOSOME_III assembly_tag annotation 3680842 3680842 . + . Note "Point mutation on a single PCR clone. G changed to an A" CHROMOSOME_III assembly_tag annotation 3681007 3681015 . + . Note "2 reads (one walk, one pcr product) read GAAGA to the left of this sequence then go into vector" CHROMOSOME_III assembly_tag annotation 3681065 3681065 . + . Note "Point mutation on a single PCR clone. A changed to a T" CHROMOSOME_III assembly_tag annotation 3681272 3681272 . + . Note "Point mutation on a single PCR clone. A changed to a G" CHROMOSOME_III assembly_tag annotation 3681366 3681366 . + . Note "Point mutation on single PCR clone. A changed to a G" CHROMOSOME_III assembly_tag annotation 3681418 3681418 . + . Note "Point mutation on a single PCR clone A changed to a G" CHROMOSOME_III assembly_tag annotation 3681501 3681501 . + . Note "Point mutation on a single PCR clone. T changed to a C" CHROMOSOME_III assembly_tag annotation 3681524 3681524 . + . Note "Point mutation on a singgle PCR clone. A changed to a G" CHROMOSOME_III assembly_tag annotation 3681525 3681525 . + . Note "Point mutation on a sinlge PCR clone. G changed to an A" CHROMOSOME_III assembly_tag annotation 3685060 3685063 . + . Note "End of C46F11 @ position 22947." CHROMOSOME_III assembly_tag annotation 3699347 3699351 . + . Note "End of T27D1 edit @ postion 37231 + 100 base overlap = 37331 Beginning of C14B1" CHROMOSOME_III assembly_tag annotation 3699348 3699351 . + . Note "beginning of C14B1" CHROMOSOME_III assembly_tag annotation 3699348 3699351 . + . Note "Beginning of C14B1." CHROMOSOME_III assembly_tag annotation 3707519 3707522 . + . Note "?end of left hand overlap??" CHROMOSOME_III assembly_tag annotation 3707520 3707523 . + . Note "?end of left hand overlap??" CHROMOSOME_III assembly_tag annotation 3728587 3728590 . + . Note "beginning of F34D10" CHROMOSOME_III assembly_tag annotation 3728589 3728592 . + . Note "beginning of F34D10" CHROMOSOME_III assembly_tag annotation 3728589 3728592 . + . Note "beginning of F34D10" CHROMOSOME_III assembly_tag comment 3730494 3730515 . + . Note "?messy" CHROMOSOME_III assembly_tag comment 3733035 3733040 . + . Note "?really e2" CHROMOSOME_III assembly_tag comment 3733528 3733535 . + . Note "?wrong name (e2)" CHROMOSOME_III assembly_tag annotation 3760704 3760708 . + . Note "Left Hand end of C44F1 " CHROMOSOME_III assembly_tag annotation 3764182 3764182 . + . Note "abi machine fault possibly more than likely. See if any other y50d7 reads have the same I'd edit this. If other reads show the same edit and leave. If just this read edit and annotate as mutation" CHROMOSOME_III assembly_tag annotation 3768357 3768360 . + . Note "putative end of F34D10" CHROMOSOME_III assembly_tag annotation 3774914 3774914 . + . Note "point mutation of a G to a T in traces 1856 and 1857" CHROMOSOME_III assembly_tag annotation 3777069 3777069 . + . Note "point mutation of a singlr base A to G" CHROMOSOME_III assembly_tag cosmid 3779804 3779807 . + . Note "vector: Left hand end of T24A11" CHROMOSOME_III assembly_tag annotation 3779804 3779807 . + . Note "Start of T24A11" CHROMOSOME_III assembly_tag annotation 3786831 3786831 . + . Note "singe read has extra CT" CHROMOSOME_III assembly_tag annotation 3799491 3799512 . + . Note "Single stranded with terminator" CHROMOSOME_III assembly_tag annotation 3801504 3801560 . + . Note "single stranded with terminator" CHROMOSOME_III assembly_tag annotation 3806176 3806176 . + . Note "point mutation in PCR" CHROMOSOME_III assembly_tag annotation 3806320 3806320 . + . Note "point mutation" CHROMOSOME_III assembly_tag annotation 3806349 3806349 . + . Note "Edited according to consensus although some traces may have a point mutation" CHROMOSOME_III assembly_tag annotation 3806452 3806452 . + . Note "point mutation of C to T on traces 1724, 1718, 1721, 1726" CHROMOSOME_III assembly_tag annotation 3808483 3808483 . + . Note "point mutatuion of A to G" CHROMOSOME_III assembly_tag annotation 3808992 3809011 . + . Note "single stranded with terminator across region" CHROMOSOME_III assembly_tag cosmid 3810358 3810363 . + . Note "vector: start of R13G10" CHROMOSOME_III assembly_tag Clone 3828565 3828568 . + . Note "left end: Beginning of C36A4" CHROMOSOME_III assembly_tag Clone 3849403 3849408 . + . Note "right end: End of R13G10" CHROMOSOME_III assembly_tag Clone 3868610 3868613 . + . Note "left end: Beginning of F13B10" CHROMOSOME_III assembly_tag Clone 3868610 3868613 . + . Note "left end: Beginning of F13B10" CHROMOSOME_III assembly_tag Clone 3873202 3873205 . + . Note "right end: End of C36A4" CHROMOSOME_III assembly_tag annotation 3877449 3877479 . + . Note "There proved to be an indeterminable number of Gs in this region. The current estimate is that the number of Gs is about 31 but sequence beyond the run of Gs is poorly determined on the + strand. " CHROMOSOME_III assembly_tag annotation 3877480 3877568 . + . Note "Missing + d.s. following a large run of Gs : (approx. 90 bp missing) but available - strand is terminated." CHROMOSOME_III assembly_tag annotation 3877711 3877735 . + . Note "Missing approx. 24 bp + d.s. but sequence confirmed by terminator on - strand." CHROMOSOME_III assembly_tag Clone 3890463 3890466 . + . Note "left end: Beginning of ZK1058" CHROMOSOME_III assembly_tag annotation 3894937 3895253 . + . Note "This is the beginning of an extensive region (approx 3kb) of multiple tandem repeats. There are regions which have not been sequenced on both strands. Five repeat elements have been identified which are already known (Naclerio et.al. (1992) J. Mol. Biol. 226, pp159-168 : From restriction digest and PCR information we are missing copies of element 3 and element 5 (in total, approx 800 bp are missing). The approx. copy number and size of each element is given in the tag annotation. Element 1 :7 copies of Rc123 (a 123mer)." CHROMOSOME_III assembly_tag Clone 3895028 3895032 . + . Note "right end: " CHROMOSOME_III assembly_tag Clone 3895150 3895156 . + . Note "right end: " CHROMOSOME_III assembly_tag annotation 3895254 3895403 . + . Note "Element 1 : 7 copies of Rc123 (a 123mer) " CHROMOSOME_III assembly_tag Clone 3895263 3895267 . + . Note "right end: " CHROMOSOME_III assembly_tag Clone 3895386 3895390 . + . Note "right end: " CHROMOSOME_III assembly_tag annotation 3895404 3895624 . + . Note "7 copies of Rc123 (a 123mer)_" CHROMOSOME_III assembly_tag Clone 3895498 3895502 . + . Note "right end: " CHROMOSOME_III assembly_tag Clone 3895621 3895626 . + . Note "right end: " CHROMOSOME_III assembly_tag annotation 3895625 3895777 . + . Note "7 copies of Rc123 (a 123mer) " CHROMOSOME_III assembly_tag Clone 3895734 3895736 . + . Note "right end: " CHROMOSOME_III assembly_tag annotation 3895897 3896216 . + . Note "Element 2 : 8 copies of RcC9 (40mer)" CHROMOSOME_III assembly_tag annotation 3896258 3896389 . + . Note "Element 3 : a minimum of 33 copies of RcD1 (a 15mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3896390 3896488 . + . Note "Element 3 : a minimum of 33 copies of RcD1 (a 15mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3896489 3896614 . + . Note "Element 3 : a minimum of 33 copies of RcD1 (a 15mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3896615 3896755 . + . Note "Element 3 : a minimum of 33 copies of RcD1 (a 15mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3896760 3896954 . + . Note "Element 4 : 8 copies of Rc35 (a 35mer)." CHROMOSOME_III assembly_tag annotation 3896955 3897038 . + . Note "Element 4 : 8 copies of Rc35 (a 35mer)." CHROMOSOME_III assembly_tag annotation 3897071 3897235 . + . Note "Element 5 : a minimum of 15 copies of RcC9 (a 40mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3897236 3897326 . + . Note "Element 5 : a minimum of 15 copies of RcC9 (a 40mer) from 28450 to 29060 bp. An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3897327 3897502 . + . Note "Element 5 : a minimum of 15 copies of RcC9 (a 40mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3897503 3897687 . + . Note "Element 5 : a minimum of 15 copies of RcC9 (a 40mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag Clone 3905418 3905421 . + . Note "right end: End of F13B10" CHROMOSOME_III assembly_tag Clone 3905418 3905421 . + . Note "right end: end of F13B10" CHROMOSOME_III assembly_tag Clone 3919461 3919464 . + . Note "left end: Start of F37A8" CHROMOSOME_III assembly_tag annotation 3926481 3926504 . + . Note "OVERLAP WITH ZK1058" CHROMOSOME_III assembly_tag ignore 3926492 3926496 . + . Note "cutoff (cloning vector): Lorist6 " CHROMOSOME_III assembly_tag cosmid 3926492 3926496 . + . Note "vector: " CHROMOSOME_III assembly_tag Clone 3926497 3926500 . + . Note "right end: " CHROMOSOME_III assembly_tag ignore 3935326 3935330 . + . Note "cutoff (cloning vector): Lorist6 " CHROMOSOME_III assembly_tag annotation 3941266 3941283 . + . Note "Beginning of overlap with R10E9 " CHROMOSOME_III assembly_tag annotation 3960788 3960796 . + . Note "END OF F37A8" CHROMOSOME_III assembly_tag ignore 3960924 3960927 . + . Note "cutoff (cloning vector): " CHROMOSOME_III assembly_tag cosmid 3960924 3960927 . + . Note "vector: " CHROMOSOME_III assembly_tag Finished 3981802 3981807 . + . Note "Left: Y1A5A" CHROMOSOME_III assembly_tag Clone 3981902 3981907 . + . Note "right end: R10E9" CHROMOSOME_III assembly_tag annotation 3981902 3981907 . + . Note "END OF R10E9" CHROMOSOME_III assembly_tag cosmid 3982016 3982027 . + . Note "vector: " CHROMOSOME_III assembly_tag Finished 3987861 3987864 . + . Note "Left: C36E8" CHROMOSOME_III assembly_tag Clone 3987861 3987864 . + . Note "left end: C36E8" CHROMOSOME_III assembly_tag Clone 3987861 3987864 . + . Note "left end: C36E8" CHROMOSOME_III assembly_tag Finished 3987961 3987964 . + . Note "Right: Y1A5A" CHROMOSOME_III assembly_tag comment 3990419 3990419 . + . Note "add C jes 30-12-01" CHROMOSOME_III assembly_tag annotation 4018224 4018293 . - . Note "single-stranded only (60bp). region has been terminated on the -ve strand." CHROMOSOME_III assembly_tag Clone 4019566 4019569 . - . Note "left end: T02C12" CHROMOSOME_III assembly_tag Finished 4019666 4019669 . + . Note "Right: C36E8" CHROMOSOME_III assembly_tag annotation 4026626 4026631 . + . Note "C36E8 ENDS" CHROMOSOME_III assembly_tag annotation 4042226 4042237 . + . Note "E03A3 BEGINS" CHROMOSOME_III assembly_tag annotation 4052042 4052044 . + . Note "only base that differs ! (in one clone only CTCC : in all others -10- reads CCCC)" CHROMOSOME_III assembly_tag annotation 4055659 4055669 . + . Note "End of T02C12" CHROMOSOME_III assembly_tag annotation 4081423 4081432 . + . Note "beginning of C03C10" CHROMOSOME_III assembly_tag annotation 4081424 4081441 . + . Note "beginning of C03C10" CHROMOSOME_III assembly_tag annotation 4085208 4085228 . + . Note "end of overlap with E03A3" CHROMOSOME_III assembly_tag annotation 4102621 4102645 . + . Note "start of overlap with C30D11" CHROMOSOME_III assembly_tag cosmid 4125157 4125171 . + . Note "vector: From here onwards is C30D11 Before here is C03C10" CHROMOSOME_III assembly_tag annotation 4142626 4142629 . + . Note "Beginning of C16C10" CHROMOSOME_III assembly_tag cosmid 4142626 4142639 . + . Note "vector: C16C10 starts here" CHROMOSOME_III assembly_tag annotation 4145647 4145649 . + . Note "2 -ve clones were tried and didn't work but there is a +ve terminator across so edited" CHROMOSOME_III assembly_tag annotation 4146877 4146880 . + . Note "End of C30D11" CHROMOSOME_III assembly_tag annotation 4154920 4154922 . + . Note "Edited to GTT - Andrew's advice" CHROMOSOME_III assembly_tag annotation 4166607 4166618 . + . Note "+ reads say 12 A's - reads say 11 A's" CHROMOSOME_III assembly_tag annotation 4183106 4183106 . + . Note "Definitely a G Other reads clearly state A" CHROMOSOME_III assembly_tag annotation 4183831 4183836 . + . Note "Beginning of R74" CHROMOSOME_III assembly_tag annotation 4183831 4183847 . + . Note "beginning of R74" CHROMOSOME_III assembly_tag annotation 4183922 4183938 . + . Note "end of C16C10" CHROMOSOME_III assembly_tag annotation 4183935 4183938 . + . Note "End of C16C10" CHROMOSOME_III assembly_tag annotation 4208576 4208579 . + . Note "beginning of F43C1" CHROMOSOME_III assembly_tag annotation 4208578 4208586 . + . Note "beginning of F43C1" CHROMOSOME_III assembly_tag annotation 4209206 4209267 . + . Note "685bp to 746bp = region of poor data on one strand only (-) part of an area of tandem repeats 5 copies of 22bp element GATCCCACTCAAACACCAAGTA" CHROMOSOME_III assembly_tag annotation 4224084 4224089 . + . Note "end of R74" CHROMOSOME_III assembly_tag Finished 4243660 4243663 . + . Note "Left: Y44F5A" CHROMOSOME_III assembly_tag annotation 4243760 4243763 . + . Note "end of F43C1" CHROMOSOME_III assembly_tag Clone 4243760 4243763 . + . Note "right end: F43C1" CHROMOSOME_III assembly_tag Clone 4249702 4249705 . + . Note "left end: T08A11 left" CHROMOSOME_III assembly_tag Clone 4249702 4249705 . + . Note "left end: T08A11" CHROMOSOME_III assembly_tag Finished 4249702 4249705 . + . Note "Left: " CHROMOSOME_III assembly_tag Finished 4249802 4249805 . - . Note "Right: Y44F5A" CHROMOSOME_III assembly_tag annotation 4250129 4250139 . + . Note "insecure" CHROMOSOME_III assembly_tag annotation 4254115 4254127 . + . Note "left end of stem" CHROMOSOME_III assembly_tag annotation 4255451 4255522 . + . Note "ss, but matches inv repeat " CHROMOSOME_III assembly_tag annotation 4257144 4257156 . + . Note "right end of stem G on single read" CHROMOSOME_III assembly_tag Clone 10302297 10302301 . + . Note "right end: K10G9 right end " CHROMOSOME_III assembly_tag Clone 10302303 10302306 . + . Note "right end: K10G9" CHROMOSOME_III assembly_tag annotation 10309172 10309172 . + . Note "point mutation C > T on single read" CHROMOSOME_III assembly_tag annotation 10320143 10320221 . + . Note "?This region has proved almost impossible to sequence through. For this reason the sequence at this point in particular and across this whole inverted repeat region are not to be regarded as 100% accurate" CHROMOSOME_III assembly_tag annotation 10320151 10320155 . + . Note "This region has proved almost impossible to sequence through. For this reason the sequence at this point in particular and across this whole inverted repeat region are not to be regarded as 100% accurate" CHROMOSOME_III assembly_tag Clone 10323972 10323975 . + . Note "left end: T07C4 START" CHROMOSOME_III assembly_tag Finished 10323972 10323975 . + . Note "Left: T07C4" CHROMOSOME_III assembly_tag Clone 10323972 10323975 . + . Note "left end: Start of overlap with T07C4" CHROMOSOME_III assembly_tag Clone 10332812 10332815 . + . Note "right end: END of T07A5" CHROMOSOME_III assembly_tag annotation 10357345 10357347 . + . Note "Start of C38H2 " CHROMOSOME_III assembly_tag Clone 10357345 10357348 . + . Note "left end: START of C38H2" CHROMOSOME_III assembly_tag Finished 10357345 10357347 . - . Note "Left: C38H2" CHROMOSOME_III assembly_tag Finished 10357445 10357448 . + . Note "Right: T07C4" CHROMOSOME_III assembly_tag annotation 10368718 10368719 . + . Note "Submit as CC (majority of reads in pjb8). Note when in cosmid vector Lorist 4 it is CG. " CHROMOSOME_III assembly_tag annotation 10368718 10368719 . - . Note "Submit as CC (majority of reads in pjb8). Note when in cosmid vector Lorist 4 it is CG. " CHROMOSOME_III assembly_tag annotation 10389194 10389196 . + . Note "Beginning of overlap with M03C11" CHROMOSOME_III assembly_tag annotation 10389194 10389199 . + . Note "left hand end" CHROMOSOME_III assembly_tag Finished 10389291 10389294 . - . Note "Right: C38H2" CHROMOSOME_III assembly_tag annotation 10394870 10394876 . + . Note "end of C38H2" CHROMOSOME_III assembly_tag annotation 10398513 10398543 . + . Note "weak data in repeat region but probably correct" CHROMOSOME_III assembly_tag Finished 10429870 10429873 . + . Note "Left: H04D03" CHROMOSOME_III assembly_tag annotation 10429967 10429973 . + . Note "right hand end" CHROMOSOME_III assembly_tag Clone 10429970 10429973 . + . Note "right end: M03C11" CHROMOSOME_III assembly_tag Clone 10450849 10450852 . - . Note "left end: D2045" CHROMOSOME_III assembly_tag Clone 10450849 10450852 . - . Note "left end: D2045" CHROMOSOME_III assembly_tag Finished 10450849 10450852 . - . Note "Left: D2045" CHROMOSOME_III assembly_tag Finished 10450949 10450952 . + . Note "Right: H04D03" CHROMOSOME_III assembly_tag Finished 10487994 10487997 . + . Note "Left: F43D9" CHROMOSOME_III assembly_tag Clone 10487994 10487997 . - . Note "left end: F43D9" CHROMOSOME_III assembly_tag Finished 10488094 10488097 . + . Note "Right: D2045" CHROMOSOME_III assembly_tag annotation 10520506 10520509 . + . Note "LH end T21C12" CHROMOSOME_III assembly_tag Clone 10520506 10520509 . + . Note "left end: Beginning of T21C12" CHROMOSOME_III assembly_tag Finished 10520691 10520694 . - . Note "Right: F43D9" CHROMOSOME_III assembly_tag annotation 10521016 10521028 . + . CHROMOSOME_III assembly_tag Clone 10525793 10525796 . + . Note "right end: End of F43D9" CHROMOSOME_III assembly_tag annotation 10525793 10525797 . + . Note "Rh end of F43D9 Lorist 6" CHROMOSOME_III assembly_tag annotation 10531168 10531178 . + . CHROMOSOME_III assembly_tag annotation 10532820 10532840 . + . CHROMOSOME_III assembly_tag annotation 10544047 10544197 . + . Note "No + d.s. across bases 23541 to 23692 (approx 150 bp). Sequence confirmed by terminators on opposite strand." CHROMOSOME_III assembly_tag annotation 10549053 10549150 . + . Note "No + d.s. across bases 28546 to 28645 (100bp). Sequence confirmed by terminators on opposite strand." CHROMOSOME_III assembly_tag Finished 10559160 10559165 . + . Note "Left: Y45F3A" CHROMOSOME_III assembly_tag Clone 10559260 10559265 . + . Note "right end: T21C12" CHROMOSOME_III assembly_tag annotation 10559287 10559292 . + . Note "RH end of T21C12 Lorist 2" CHROMOSOME_III assembly_tag Clone 10559289 10559292 . + . Note "right end: End of T21C12" CHROMOSOME_III assembly_tag oligo 10563743 10563759 . + . Note "serial#=Y45F3.9 \nsequence=GTAAATCGACATCAGCG\nflags=\n" CHROMOSOME_III assembly_tag oligo 10566075 10566093 . - . Note "serial#=Y45F3.5 \ntemplate=sr58a3\nsequence=GGAGTAATCTGTATAATGG\nflags=\n" CHROMOSOME_III assembly_tag annotation 10566891 10567280 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSonicated pUC clones from sr66e5" CHROMOSOME_III assembly_tag annotation 10567364 10567684 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSonicated pUC clones from sr66e5" CHROMOSOME_III assembly_tag annotation 10567847 10567930 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSonicated pUC clones from sr59f1" CHROMOSOME_III assembly_tag oligo 10568207 10568224 . - . Note "serial#=Y45F3.6 \ntemplate=\nsequence=ATCTCTTAGCGAAAACTG\nflags=\n" CHROMOSOME_III assembly_tag annotation 10568229 10568319 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSonicated pUC clones from sr59f1" CHROMOSOME_III assembly_tag oligo 10568605 10568621 . - . Note "serial#=Y45F3.3 \ntemplate=sr59f1.p1U \nsequence=TTCCGTAGAGGTTTAGG\nflags=\n" CHROMOSOME_III assembly_tag Clone 10595708 10595713 . + . Note "left end: Y39A1" CHROMOSOME_III assembly_tag Finished 10595708 10595713 . + . Note "Left: Y39A1A" CHROMOSOME_III assembly_tag Clone 10595708 10595713 . - . Note "left end: Y39A1\n\n" CHROMOSOME_III assembly_tag Finished 10595808 10595813 . + . Note "Right: Y45F3A" CHROMOSOME_III assembly_tag annotation 10603684 10603687 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\n" CHROMOSOME_III assembly_tag annotation 10654299 10654326 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\n" CHROMOSOME_III assembly_tag Clone 10706562 10706567 . + . Note "left end: W09D10" CHROMOSOME_III assembly_tag Clone 10706561 10706568 . - . Note "left end: W09D10" CHROMOSOME_III assembly_tag Finished 10706561 10706568 . - . Note "Left: W09D10" CHROMOSOME_III assembly_tag Finished 10706662 10706667 . + . Note "Right: Y39A1A" CHROMOSOME_III assembly_tag Clone 10721866 10721869 . - . Note "left end: K01G5" CHROMOSOME_III assembly_tag annotation 10732486 10732501 . - . Note "number of Cs may not be accurate.\nsome M13 subclones have deleted." CHROMOSOME_III assembly_tag Finished 10740378 10740381 . + . Note "Left: K01G5" CHROMOSOME_III assembly_tag Finished 10740478 10740481 . + . Note "Right: W09D10" CHROMOSOME_III assembly_tag Clone 10740478 10740481 . + . Note "right end: W09D10" CHROMOSOME_III assembly_tag Clone 10740478 10740481 . - . Note "left end: W09D10" CHROMOSOME_III assembly_tag Finished 10759716 10759719 . + . Note "Left: Y39A1B" CHROMOSOME_III assembly_tag Clone 10759816 10759819 . + . Note "right end: K01G5" CHROMOSOME_III assembly_tag Clone 10759816 10759819 . - . Note "right end: K01G5" CHROMOSOME_III assembly_tag Finished 10759816 10759819 . - . Note "Right: K01G5" CHROMOSOME_III assembly_tag Clone 10798135 10798138 . + . Note "left end: K11D9" CHROMOSOME_III assembly_tag Finished 10798135 10798138 . - . Note "Left: K11D9" CHROMOSOME_III assembly_tag Clone 10798135 10798138 . - . Note "left end: K11D9" CHROMOSOME_III assembly_tag Finished 10798235 10798238 . + . Note "Right: Y39A1B" CHROMOSOME_III assembly_tag annotation 10806867 10806884 . + . Note "no. of Gs may not be accurate." CHROMOSOME_III assembly_tag Clone 10807253 10807258 . - . Note "right end: R17" CHROMOSOME_III assembly_tag annotation 10829489 10829521 . - . Note "Single pUC clone covering this region." CHROMOSOME_III assembly_tag Finished 10830236 10830239 . - . Note "Left: R17" CHROMOSOME_III assembly_tag Clone 10830336 10830339 . - . Note "right end: K11D9 left end" CHROMOSOME_III assembly_tag Clone 10830336 10830339 . - . Note "right end: K11D9" CHROMOSOME_III assembly_tag Finished 10830336 10830339 . - . Note "Right: K11D9" CHROMOSOME_III assembly_tag Finished 10850149 10850154 . + . Note "Left: Y39A1C" CHROMOSOME_III assembly_tag Clone 10850249 10850254 . + . Note "right end: R17" CHROMOSOME_III assembly_tag Finished 10850249 10850254 . - . Note "Right: R17" CHROMOSOME_III assembly_tag Clone 10850249 10850254 . - . Note "right end: R17" CHROMOSOME_III assembly_tag Finished 10868191 10868194 . + . Note "Left: C44B9" CHROMOSOME_III assembly_tag Clone 10868191 10868194 . + . Note "left end: C44B9" CHROMOSOME_III assembly_tag Clone 10868191 10868194 . - . Note "left end: C44B9" CHROMOSOME_III assembly_tag Finished 10868291 10868294 . + . Note "Right: Y39A1C" CHROMOSOME_III assembly_tag comment 10875926 10875926 . + . Note "deleted base" CHROMOSOME_III assembly_tag comment 10890891 10890891 . + . Note "restored G 31-12-01 jes" CHROMOSOME_III assembly_tag Clone 10902788 10902791 . + . Note "left end: M142" CHROMOSOME_III assembly_tag Finished 10902788 10902791 . + . Note "Left: M142" CHROMOSOME_III assembly_tag Clone 10902788 10902791 . - . Note "left end: M142" CHROMOSOME_III assembly_tag Finished 10902888 10902891 . + . Note "Right: C44B9" CHROMOSOME_III assembly_tag Clone 10907843 10907846 . + . Note "right end: C44B9" CHROMOSOME_III assembly_tag annotation 10927008 10927010 . + . Note "G missing" CHROMOSOME_III assembly_tag annotation 10927008 10927010 . + . Note "G missing in a single M13 clone" CHROMOSOME_III assembly_tag Finished 10938990 10938993 . + . Note "Left: Y52D3" CHROMOSOME_III assembly_tag Clone 10939090 10939093 . + . Note "right end: M142" CHROMOSOME_III assembly_tag Finished 10939090 10939093 . + . Note "Right: M142" CHROMOSOME_III assembly_tag Clone 10939090 10939093 . + . Note "right end: End of M142" CHROMOSOME_III assembly_tag Clone 10939093 10939093 . + . Note "left end: " CHROMOSOME_III assembly_tag Finished 10947344 10947349 . + . Note "Left: Y48A6A" CHROMOSOME_III assembly_tag Clone 10947344 10947349 . + . Note "left end: Y48A6A" CHROMOSOME_III assembly_tag Clone 10947344 10947349 . + . Note "left end: " CHROMOSOME_III assembly_tag Finished 10947444 10947449 . + . Note "Right: " CHROMOSOME_III assembly_tag Clone 10954544 10954547 . + . Note "right end: Y48A6A" CHROMOSOME_III assembly_tag Clone 10954544 10954547 . + . Note "left end: W05B2" CHROMOSOME_III assembly_tag Clone 10954544 10954547 . - . Note "left end: W05B2" CHROMOSOME_III assembly_tag Finished 10954544 10954547 . - . Note "Left: W05B2" CHROMOSOME_III assembly_tag Finished 10954640 10954643 . + . Note "Right: Y48A6A" CHROMOSOME_III assembly_tag Finished 10989973 10989976 . + . Note "Left: Y48A6B" CHROMOSOME_III assembly_tag Finished 10990068 10990073 . - . Note "Right: W05B2" CHROMOSOME_III assembly_tag Clone 10990068 10990073 . - . Note "right end: W05B2" CHROMOSOME_III assembly_tag annotation 11004501 11004512 . + . Note "tandem repeat between 57320 - 59030 so\ncovering 1.7kb . \n70 copies of CAATCTATTTTTTGGTATG\n80 copies of TTTTTTGGTATG\n76 copies of CAATCTATTTTTT\nassembled correct as possible according\nto read pairs, not yet confirmed by\ndigest." CHROMOSOME_III assembly_tag annotation 11052019 11052024 . + . Note "clone so42c6 has been sized and is as\npredicted so inverted repeat asembled\ncorrectly." CHROMOSOME_III assembly_tag Clone 11064945 11064948 . + . Note "left end: W09D6" CHROMOSOME_III assembly_tag Clone 11064945 11064948 . + . Note "left end: W09D6" CHROMOSOME_III assembly_tag Finished 11064945 11064948 . - . Note "Left: W09D6" CHROMOSOME_III assembly_tag Finished 11065042 11065045 . + . Note "Right: Y48A6B" CHROMOSOME_III assembly_tag Finished 11100344 11100347 . + . Note "Left: Y48A6C" CHROMOSOME_III assembly_tag Finished 11100444 11100447 . + . Note "Right: W09D6" CHROMOSOME_III assembly_tag Clone 11100444 11100447 . + . Note "right end: W09D6" CHROMOSOME_III assembly_tag Clone 11100444 11100447 . + . Note "right end: W09D6" CHROMOSOME_III assembly_tag Clone 11135979 11135984 . + . Note "left end: Y47D3" CHROMOSOME_III assembly_tag Clone 11135979 11135984 . + . Note "left end: Y47D3" CHROMOSOME_III assembly_tag Finished 11135979 11135984 . + . Note "Left: Y47D3A" CHROMOSOME_III assembly_tag Finished 11136079 11136082 . + . Note "Right: Y48A6C" CHROMOSOME_III assembly_tag annotation 11150140 11150147 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nPrimer read only. Loop of inverted\nrepeat." CHROMOSOME_III assembly_tag annotation 11150148 11150208 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here -\nPrimer reads only." CHROMOSOME_III assembly_tag Clone 11197697 11197700 . + . Note "left end: C41D8" CHROMOSOME_III assembly_tag Clone 11217204 11217209 . - . Note "right end: Y48A6" CHROMOSOME_III assembly_tag annotation 11330104 11330121 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nPrimer read\n" CHROMOSOME_III assembly_tag Finished 11335692 11335695 . - . Note "Left: T28D6" CHROMOSOME_III assembly_tag Clone 11335692 11335695 . - . Note "left end: T28D6" CHROMOSOME_III assembly_tag Finished 11335789 11335792 . + . Note "Right: Y47D3A" CHROMOSOME_III assembly_tag Finished 11375663 11375666 . + . Note "Left: Y47D3B" CHROMOSOME_III assembly_tag Finished 11375763 11375766 . - . Note "Right: T28D6" CHROMOSOME_III assembly_tag Clone 11375763 11375766 . - . Note "right end: T28D6 " CHROMOSOME_III assembly_tag annotation 11428909 11435746 . + . Note "[x] Tandem repeat \n[ ] Single clone region \n[ ] Forced join \n[ ] Other \nComment\n159 copies of a 43bp repeat.\nContains 3 forced joins and some single\nclone regions." CHROMOSOME_III assembly_tag Clone 11437518 11437521 . + . Note "left end: H10N23" CHROMOSOME_III assembly_tag Finished 11471525 11471528 . - . Note "Left: Y66A7AL" CHROMOSOME_III assembly_tag Clone 11471625 11471630 . + . Note "right end: Y47D3" CHROMOSOME_III assembly_tag Clone 11471625 11471630 . + . Note "right end: Y47D3" CHROMOSOME_III assembly_tag Finished 11471627 11471630 . + . Note "Right: Y47D3B" CHROMOSOME_III assembly_tag annotation 11474717 11474736 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Uncertain number of Cs." CHROMOSOME_III assembly_tag Finished 11487262 11487267 . + . Note "Left: Y66D12A" CHROMOSOME_III assembly_tag Clone 11487362 11487368 . + . Note "right end: Y66A7AL" CHROMOSOME_III assembly_tag Finished 11487362 11487368 . + . Note "Right: Y66A7AL" CHROMOSOME_III assembly_tag Clone 11487362 11487369 . + . Note "right end: Y66A7AL" CHROMOSOME_III assembly_tag Finished 11487363 11487368 . + . Note "Left: Y66A7AR" CHROMOSOME_III assembly_tag Clone 11487363 11487368 . - . Note "left end: Y66A7AR" CHROMOSOME_III assembly_tag annotation 11497015 11497029 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - this inverted repeat may not be truncated - evidence is conflicting" CHROMOSOME_III assembly_tag annotation 11498364 11498371 . - . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in inverted repeat" CHROMOSOME_III assembly_tag annotation 11503645 11503645 . + . Note "C->G based on Thierry-Mieg EST analysis " CHROMOSOME_III assembly_tag annotation 11529220 11529412 . - . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - subclone instability in tandem repeat" CHROMOSOME_III assembly_tag annotation 11553162 11553283 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in tandem repeat" CHROMOSOME_III assembly_tag annotation 11562862 11562931 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in tandem repeat" CHROMOSOME_III assembly_tag annotation 11570555 11570588 . - . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [x] Forced join [ ] Other Add a comment here - possibly tandem IR2s" CHROMOSOME_III assembly_tag annotation 11585483 11585488 . - . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in IR2" CHROMOSOME_III assembly_tag annotation 11595210 11595408 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in tandem repeat" CHROMOSOME_III assembly_tag Clone 11601037 11601040 . + . Note "left end: C37G2" CHROMOSOME_III assembly_tag Finished 11610305 11610310 . + . Note "Right: Y66A7AL" CHROMOSOME_III assembly_tag Clone 11610305 11610310 . + . Note "right end: Y66A7AL" CHROMOSOME_III assembly_tag Clone 11610305 11610312 . + . Note "left end: Y66A7AR" CHROMOSOME_III assembly_tag Finished 11610305 11610312 . + . Note "Left: Y66A7AR" CHROMOSOME_III assembly_tag Clone 11610305 11610312 . - . Note "left end: Y66A7AR" CHROMOSOME_III assembly_tag Finished 11610405 11610410 . - . Note "Right: Y66D12A" CHROMOSOME_III assembly_tag Clone 11620964 11620969 . - . Note "right end: Y66D12A" CHROMOSOME_III assembly_tag Clone 11637775 11637780 . + . Note "left end: Y41C4" CHROMOSOME_III assembly_tag Finished 11637862 11637865 . - . Note "Right: Y66A7AR" CHROMOSOME_III assembly_tag Clone 11766732 11766735 . + . Note "left end: C24H11" CHROMOSOME_III assembly_tag annotation 11766732 11766735 . + . Note "[ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other CommentRestriction digest data (AVAI, AVAII, BAMHI, ECORI, KPNI) suggest the assembly is too large, but no way has been foundof assembling the cosmid so that it matches the digest." CHROMOSOME_III assembly_tag Finished 11766732 11766735 . + . Note "Left: C24H11" CHROMOSOME_III assembly_tag annotation 11773618 11774367 . + . Note "[x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other CommentRegion of 79bp tandem repeat. Restriction digest data do not agree with the assembly of the cosmid (the assembly is larger than indicated by the digest). Data from the restriction enzymes used (ALUI, AVAI, AVAII, BAMHI,ECORI, KPNI) conflict as to how much is missing from the assembly of this tandemrepeat. " CHROMOSOME_III assembly_tag annotation 11791821 11791824 . + . Note "[ ] Tandem repeat \n[ ] Single clone region \n[ ] Forced join \n[x] Other \nComment\nOne clone has TA, 15 clones have TAGA." CHROMOSOME_III assembly_tag annotation 11794635 11794635 . + . Note "[ ] Tandem repeat \n[ ] Single clone region \n[ ] Forced join \n[x] Other \nComment\nOne clone has C, 12 clones have A." CHROMOSOME_III assembly_tag Finished 11804482 11804485 . + . Note "Left: C18D11" CHROMOSOME_III assembly_tag Clone 11804582 11804585 . + . Note "right end: C24H11" CHROMOSOME_III assembly_tag Clone 11804582 11804585 . + . Note "right end: C24H11" CHROMOSOME_III assembly_tag Finished 11804582 11804585 . + . Note "Right: C24H11" CHROMOSOME_III assembly_tag annotation 11832879 11832895 . + . Note "this region is covered by a single clone which is a read generated from a sonication of clone sx66a5. This region is consistent with the digest" CHROMOSOME_III assembly_tag annotation 11833088 11833100 . - . Note "Region contains repeat elements. The cosmid if consistent with the digest" CHROMOSOME_III assembly_tag Finished 11833627 11833630 . + . Note "Left: Y56A3A" CHROMOSOME_III assembly_tag Clone 11833727 11833730 . + . Note "right end: C18D11\n" CHROMOSOME_III assembly_tag Finished 11833727 11833730 . + . Note "Right: C18D11" CHROMOSOME_III assembly_tag Clone 11833727 11833730 . + . Note "right end: C18D11" CHROMOSOME_III assembly_tag annotation 11857658 11857694 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\n" CHROMOSOME_III assembly_tag annotation 11861669 11861669 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[x] OtherAdd a comment here - base pair differencebetween Y56A3 & Y41C4 . Y56A3 reads aAtwhereas Y41C4 reads aTt" CHROMOSOME_III assembly_tag Clone 11895837 11895842 . + . Note "right end: Y41C4" CHROMOSOME_III assembly_tag annotation 11931839 11931892 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[x] Forced join[ ] OtherAdd a comment here - False join in small tandem repeat TAGGTATTATAGGTAT. At least 18 copies in a region of about 700 bp" CHROMOSOME_III assembly_tag annotation 11993634 11993663 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nArm of inverted repeat." CHROMOSOME_III assembly_tag Finished 12002891 12002894 . + . Note "Left: Y79H2A" CHROMOSOME_III assembly_tag Clone 12002891 12002895 . + . Note "left end: Y79H2" CHROMOSOME_III assembly_tag Clone 12002891 12002895 . + . Note "left end: Y79H2" CHROMOSOME_III assembly_tag Finished 12002986 12002990 . + . Note "Right: Y56A3A" CHROMOSOME_III assembly_tag Clone 12025661 12025666 . + . Note "right end: Y56A3" CHROMOSOME_III assembly_tag annotation 12052754 12052858 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nShort insert library made from pUC clone\nsz21h3." CHROMOSOME_III assembly_tag annotation 12068699 12068842 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here -\nReads derived from 2 PCR products both\nmade using oligos 35 and 18" CHROMOSOME_III assembly_tag Clone 12068932 12068937 . + . Note "left end: Y75B8" CHROMOSOME_III assembly_tag Clone 12068932 12068937 . + . Note "left end: Y75B8" CHROMOSOME_III assembly_tag Finished 12068932 12068937 . + . Note "Left: Y75B8A" CHROMOSOME_III assembly_tag Finished 12069031 12069034 . + . Note "Right: Y79H2A" CHROMOSOME_III assembly_tag annotation 12102648 12102771 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region only covered by a single clone sw82g1 as well as sonicated reads from this subclone" CHROMOSOME_III assembly_tag annotation 12103191 12103193 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -This area is covered only by two subclones. The subclone from the Y75B8 library reads gtg whereas the suclone from Y79H2 reads gttgg. The sequence has been edited to the sequence given by the Y75B8 clone." CHROMOSOME_III assembly_tag annotation 12118515 12118532 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[x] OtherAdd a comment here -number of g's in this run is uncertain it has been edited to the maximum ie 18" CHROMOSOME_III assembly_tag annotation 12131704 12131854 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by sonicated reads of subclone sx15g5" CHROMOSOME_III assembly_tag annotation 12161581 12161593 . + . Note "First select a Feature -[X] Unsure[ ] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -This region of 13bp is covered only by single direction dye primers. There are two subclones covering this point. The region falls in the arm of an inverted repeat." CHROMOSOME_III assembly_tag annotation 12172302 12173193 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Tandem repeat region containing false join and also single clone regions. Repeat element is 11bp long. There is variation between some of the copies." CHROMOSOME_III assembly_tag annotation 12190660 12190691 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Clone Y75B8 has deleted these copies of the tandem repeat. It has been edited to the maximum number as shown by the overlapping clones H26P12 and Y79H2." CHROMOSOME_III assembly_tag annotation 12239770 12239772 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -The sequence for the overlapping cloneY79H2 reads cAg and not cGg. This looksto be a base variation between thesetwo clones." CHROMOSOME_III assembly_tag annotation 12246539 12246818 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only by the subclone qb19b1. Region is only covered with terminator chemistry. This is contained in the arm of an inverted repeat." CHROMOSOME_III assembly_tag annotation 12247134 12247598 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only by the subclone qb19a5.Subclone has been sequenced with terminator and primer chemistries." CHROMOSOME_III assembly_tag Clone 12253439 12253442 . + . Note "right end: Y79H2" CHROMOSOME_III assembly_tag annotation 12254217 12255320 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Region contains dispersed IR-2 inverted repeat similar to sequence U86947. The repeat is flanked by a tandem duplication of the sequence CAATT. This region contains some areas of single clone. The first arm of the inverted repeat has approximately 135bp missing which has been represented with the sequence from the second arm." CHROMOSOME_III assembly_tag annotation 12262288 12262466 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by reads from a sonication of subclone sx14b2." CHROMOSOME_III assembly_tag annotation 12267417 12268208 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence ATAG. The region contains a single clone." CHROMOSOME_III assembly_tag annotation 12278845 12279899 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -The tandem repeat unit is 31bp. The area also contains a single clone region." CHROMOSOME_III assembly_tag annotation 12280762 12280800 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion only contains sonicated reads from subclone sx09f1." CHROMOSOME_III assembly_tag annotation 12288114 12288140 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Region is covered by two subclones one of which has deleted out one copy of a tandem repeat at this point." CHROMOSOME_III assembly_tag annotation 12298387 12298424 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only by a single direction primer read. This region is in an arm of an inverted repeat." CHROMOSOME_III assembly_tag annotation 12298512 12298543 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region is covered only with a single clone, which lies in the arm of an inverted repeat. " CHROMOSOME_III assembly_tag annotation 12342299 12342432 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by sonicated reads from subclone sx12c2." CHROMOSOME_III assembly_tag annotation 12345763 12348069 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -This tandem repeat region contains a forced join and also single clone regions. The repeat elements are approximately 37bp long, and show variation between the copies." CHROMOSOME_III assembly_tag annotation 12353200 12353236 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region is covered only by a single clone. The subclone has been sequenced with both chemistries." CHROMOSOME_III assembly_tag Clone 12367231 12367236 . + . Note "left end: Y49E10" CHROMOSOME_III assembly_tag Finished 12367231 12367236 . + . Note "Left: Y49E10" CHROMOSOME_III assembly_tag Clone 12367231 12367236 . + . Note "left end: Y49E10" CHROMOSOME_III assembly_tag Finished 12367332 12367337 . + . Note "Right: Y75B8A" CHROMOSOME_III assembly_tag annotation 12376365 12376376 . - . Note "[ ] Tandem repeat \n[X] Single clone region \n[ ] Forced join \n[ ] Other \nComment\nRegion is covered only by a single clone.\nRegion consistent with the digest." CHROMOSOME_III assembly_tag Clone 12401810 12401815 . + . Note "right end: Y75B8" CHROMOSOME_III assembly_tag Clone 12403461 12403466 . + . Note "left end: Y111B2" CHROMOSOME_III assembly_tag annotation 12408222 12408229 . + . Note "[ ] Tandem repeat \n[X] Single clone region \n[ ] Forced join \n[ ] Other \nComment\nRegion covered by sonicated library of clone sr36a5." CHROMOSOME_III assembly_tag annotation 12415985 12416050 . + . Note "[ ] Tandem repeat \n[X] Single clone region \n[ ] Forced join \n[ ] Other \nComment\nRegion is covered only by one clone but is consistent with the digest." CHROMOSOME_III assembly_tag annotation 12423436 12423468 . + . Note "[ ] Tandem repeat \n[X] Single clone region \n[ ] Forced join \n[ ] Other \nComment\nSingle clone region containing reads from a sonication of clone sp26f9." CHROMOSOME_III assembly_tag Finished 12492716 12492721 . + . Note "Left: Y111B2A" CHROMOSOME_III assembly_tag Finished 12492815 12492820 . + . Note "Right: Y49E10" CHROMOSOME_III assembly_tag Clone 12492815 12492820 . + . Note "right end: Y49E10" CHROMOSOME_III assembly_tag annotation 12493758 12493802 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - SIL of sp27c12 " CHROMOSOME_III assembly_tag annotation 12507119 12507206 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - primers only here " CHROMOSOME_III assembly_tag annotation 12563165 12563200 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - single direction primers in inverted repeat " CHROMOSOME_III assembly_tag annotation 12602970 12603260 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - this region contains reads from SIL of sp15g11 " CHROMOSOME_III assembly_tag annotation 12603442 12603567 . + . Note "First select a Feature - [ ] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - join made using repK data " CHROMOSOME_III assembly_tag annotation 12603443 12603568 . + . Note "First select a Feature - [ ] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - join made using repK data " CHROMOSOME_III assembly_tag annotation 12609986 12610148 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - primer only over inverted repeat " CHROMOSOME_III assembly_tag annotation 12609990 12609990 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - primers only here, unable to sequence terminators. " CHROMOSOME_III assembly_tag annotation 12610353 12610412 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - single direction primers only here " CHROMOSOME_III assembly_tag annotation 12670978 12671022 . + . Note "First select a Feature - [ ] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - join confirmed by inv. rpt " CHROMOSOME_III assembly_tag annotation 12678744 12679994 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Repeat contains 156bp single clone region. so95e8 SIL confirms join but does not cover the single clone region. Edited to the remainder of the repeat. " CHROMOSOME_III assembly_tag annotation 12716121 12716158 . + . Note "First select a Feature - [ ] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - area contained within IR-2 rpt, bridged by so82b5 and sp12c12 " CHROMOSOME_III assembly_tag annotation 12716171 12716203 . + . Note "First select a Feature - [ ] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - area contained within IR-2 rpt, bridged by so82b5 and sp12c12 " CHROMOSOME_III assembly_tag annotation 12720758 12720776 . - . Note "First select a Feature - [ ] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - join confirmed by repH sequence " CHROMOSOME_III assembly_tag annotation 12733008 12733016 . + . Note "First select a Feature - [ ] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - join confirmed by repJ " CHROMOSOME_III assembly_tag Finished 12750313 12750318 . + . Note "Left: ZC482" CHROMOSOME_III assembly_tag Clone 12750313 12750318 . + . Note "left end: ZC482" CHROMOSOME_III assembly_tag Finished 12750413 12750418 . + . Note "Right: Y111B2A" CHROMOSOME_III assembly_tag Finished 12786507 12786510 . + . Note "Left: BE10" CHROMOSOME_III assembly_tag Clone 12786609 12786614 . + . Note "right end: ZC482" CHROMOSOME_III assembly_tag Clone 12786609 12786614 . + . Note "right end: ZC482" CHROMOSOME_III assembly_tag Finished 12786609 12786614 . + . Note "Right: ZC482" CHROMOSOME_III assembly_tag Finished 12816739 12816742 . + . Note "Left: Y37D8A" CHROMOSOME_III assembly_tag Clone 12816839 12816842 . + . Note "right end: BE10" CHROMOSOME_III assembly_tag Finished 12816839 12816842 . + . Note "Right: BE10" CHROMOSOME_III assembly_tag Clone 12816839 12816842 . + . Note "right end: BE10" CHROMOSOME_III assembly_tag annotation 12872939 12873712 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence GTACT." CHROMOSOME_III assembly_tag annotation 12903031 12903821 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence ACATT." CHROMOSOME_III assembly_tag annotation 12923081 12923909 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. This copy of the repeat does not have a flanking duplicated sequence.This copy also contains a region which is covered only by one subclone." CHROMOSOME_III assembly_tag annotation 12932692 12933189 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. In this copy the arms are shorter by approximately bp also there is no flanking duplication of sequence. The sequence which gives rise to the shortened version of this repeat is derived from subclones from two yac clones." CHROMOSOME_III assembly_tag annotation 12947860 12947862 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[X] Other\nAdd a comment here -\nThe overlapping clone Y111B2 reads GGG at this point." CHROMOSOME_III assembly_tag Clone 12949375 12949380 . + . Note "left end: Y39E4A" CHROMOSOME_III assembly_tag Finished 12949375 12949380 . + . Note "Left: Y39E4A" CHROMOSOME_III assembly_tag Clone 12949375 12949380 . - . Note "left end: Y39E4" CHROMOSOME_III assembly_tag Finished 12949475 12949480 . + . Note "Right: Y37D8A" CHROMOSOME_III assembly_tag Clone 12975480 12975483 . + . Note "right end: Y39E4A" CHROMOSOME_III assembly_tag Finished 12975480 12975483 . + . Note "Left: ZK1010" CHROMOSOME_III assembly_tag Clone 12975480 12975483 . + . Note "left end: Beginning of ZK1010" CHROMOSOME_III assembly_tag Clone 12975480 12975483 . + . Note "left end: ZK1010" CHROMOSOME_III assembly_tag Finished 12975580 12975583 . + . Note "Right: Y39E4A" CHROMOSOME_III assembly_tag annotation 12999244 12999246 . + . Note "all stolen reads say 9 A's, but all \nother reads say 8 A's so edited to\nthe maximum number." CHROMOSOME_III assembly_tag annotation 12999309 12999311 . + . Note "all stolen reads say 12 G's, but all\nother reads say 13 G's so edited to\nthe maximum." CHROMOSOME_III assembly_tag Clone 13008890 13008893 . + . Note "left end: F14F7" CHROMOSOME_III assembly_tag Clone 13008890 13008893 . + . Note "left end: Beginning of F14F7" CHROMOSOME_III assembly_tag Finished 13008890 13008893 . + . Note "Left: F14F7" CHROMOSOME_III assembly_tag Finished 13008987 13008990 . + . Note "Right: ZK1010" CHROMOSOME_III assembly_tag Clone 13009342 13009345 . + . Note "right end: ZK1010" CHROMOSOME_III assembly_tag annotation 13010163 13010240 . + . CHROMOSOME_III assembly_tag annotation 13010241 13010302 . + . CHROMOSOME_III assembly_tag annotation 13012539 13012549 . + . Note "reads 277,880 and 1061 (single clone) have 3 A's and 8 T's. The rest have 4 A's and 7 T's.\n\nEdited to 4 A's and 7 T's." CHROMOSOME_III assembly_tag annotation 13012589 13012591 . + . Note "reads 277, 880 and 1061 (a single clone) have ATG but all other reads have AGG.\n\nEdited to AGG" CHROMOSOME_III assembly_tag annotation 13031687 13032342 . + . Note "tandem repeat of length 1.1kb. \nA typical repeat element is \nTACCGCCCGCTACCACCGC (a 19-mer)" CHROMOSOME_III assembly_tag Clone 13034254 13034257 . + . Note "left end: F54F12 clone left" CHROMOSOME_III assembly_tag Finished 13034254 13034257 . + . Note "Left: " CHROMOSOME_III assembly_tag Clone 13034254 13034257 . + . Note "left end: F54F12" CHROMOSOME_III assembly_tag Finished 13034354 13034357 . + . Note "Right: F14F7" CHROMOSOME_III assembly_tag Clone 13045535 13045538 . + . Note "right end: F14F7 clone right" CHROMOSOME_III assembly_tag annotation 13065509 13065528 . - . CHROMOSOME_III assembly_tag Finished 13066865 13066868 . + . Note "Left: Y39E4B" CHROMOSOME_III assembly_tag Finished 13066965 13066968 . + . Note "Right: " CHROMOSOME_III assembly_tag Clone 13066965 13066968 . + . Note "right end: F54F12" CHROMOSOME_III assembly_tag Clone 13066965 13066968 . - . Note "right end: F54F12 clone right" CHROMOSOME_III assembly_tag annotation 13074199 13086231 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region contains a tandem repeat each copy is approximately 58bp and there is variation amongst the copies. Region also contains forced joins and single clones." CHROMOSOME_III assembly_tag annotation 13114579 13114645 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only from subcloned reads taken from a pcr product produced from yac dna." CHROMOSOME_III assembly_tag annotation 13114950 13116430 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Single clone region covered by subclone qa58a3. This subclone has been sonicated." CHROMOSOME_III assembly_tag annotation 13144988 13145057 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region only covered by subclone sl39b10. This clone has been sequenced using both chemistries. Lies in the arm of an inverted repeat." CHROMOSOME_III assembly_tag annotation 13146677 13146687 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by sonications of subclone sl35a10." CHROMOSOME_III assembly_tag annotation 13147267 13147267 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[X] Other\nAdd a comment here -\nSubclone from overlaping project Y37D8 reads AG." CHROMOSOME_III assembly_tag annotation 13147286 13148076 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence TAATC. Region also contains single clone section." CHROMOSOME_III assembly_tag Clone 13165501 13165506 . - . Note "right end: Y37D8" CHROMOSOME_III assembly_tag annotation 13192863 13192927 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only with sonicated reads from subclone sm20b2." CHROMOSOME_III assembly_tag annotation 13193186 13193975 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence TATAA." CHROMOSOME_III assembly_tag annotation 13195200 13195203 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSingle clone region containing sonicated reads from subclone sm19h10." CHROMOSOME_III assembly_tag annotation 13197972 13198416 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion only contains sonicated reads from subclone sm27e7" CHROMOSOME_III assembly_tag annotation 13199757 13199780 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by sonicated reads from subclone sm30c7." CHROMOSOME_III assembly_tag annotation 13202423 13203023 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Some subclones show a deletion at this point. A digest on subclone sm23c6 showed two bands on the gel one of which was ~600bp smaller than the other. Region of sequence contains single direction primers. Subclone sm32e11 has totoally deleted this region which contains an inverted repeat." CHROMOSOME_III assembly_tag annotation 13220761 13220774 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Yac sequence shows 14 c's but the reads from the underlying clone F09D11 all say 13. It has been edited to the consensus of the yac." CHROMOSOME_III assembly_tag Finished 13222441 13222446 . + . Note "Left: Y43F4A" CHROMOSOME_III assembly_tag Clone 13222441 13222446 . - . Note "left end: Y43F4A" CHROMOSOME_III assembly_tag Clone 13222441 13222446 . - . Note "left end: Y43F4" CHROMOSOME_III assembly_tag Finished 13222553 13222557 . + . Note "Right: Y39E4B" CHROMOSOME_III assembly_tag Clone 13246265 13246268 . + . Note "right end: Y43F4A" CHROMOSOME_III assembly_tag Clone 13246265 13246268 . - . Note "left end: F56A8" CHROMOSOME_III assembly_tag Clone 13246265 13246268 . - . Note "left end: F56A8" CHROMOSOME_III assembly_tag Finished 13246265 13246268 . - . Note "Left: F56A8" CHROMOSOME_III assembly_tag Finished 13246365 13246368 . + . Note "Right: Y43F4A" CHROMOSOME_III assembly_tag annotation 13257621 13257627 . - . Note "read 558 has AAATTTT but the rest have\nAAAATTT including a cosmid pcr" CHROMOSOME_III assembly_tag annotation 13264073 13264133 . - . Note "bases 21633 - 22471 are covered by a single clone" CHROMOSOME_III assembly_tag annotation 13264134 13264211 . - . Note "single clone" CHROMOSOME_III assembly_tag annotation 13264212 13264289 . - . Note "single clone" CHROMOSOME_III assembly_tag annotation 13264290 13264367 . - . Note "single clone" CHROMOSOME_III assembly_tag annotation 13264368 13264445 . - . Note "single clone" CHROMOSOME_III assembly_tag annotation 13264446 13264523 . - . Note "single clone" CHROMOSOME_III assembly_tag annotation 13264524 13264601 . - . CHROMOSOME_III assembly_tag annotation 13264602 13264679 . - . CHROMOSOME_III assembly_tag annotation 13264680 13264757 . - . CHROMOSOME_III assembly_tag annotation 13264758 13264834 . - . CHROMOSOME_III assembly_tag annotation 13264835 13264910 . - . Note "bases 21633 - 22471 are covered by a single clone" CHROMOSOME_III assembly_tag annotation 13281363 13281365 . - . CHROMOSOME_III assembly_tag annotation 13281416 13281417 . - . CHROMOSOME_III assembly_tag annotation 13281419 13281420 . - . CHROMOSOME_III assembly_tag annotation 13282162 13282220 . - . Note "bases 4324 - 4382 in the inverted repeat are covered by a single clone" CHROMOSOME_III assembly_tag Finished 13286440 13286443 . + . Note "Left: Y43F4B" CHROMOSOME_III assembly_tag Clone 13286540 13286543 . + . Note "left end: Y43F4B" CHROMOSOME_III assembly_tag Clone 13286540 13286543 . + . Note "right end: F56A8" CHROMOSOME_III assembly_tag Clone 13286540 13286543 . - . Note "right end: F56A8" CHROMOSOME_III assembly_tag Finished 13286540 13286543 . - . Note "Right: F56A8" CHROMOSOME_III assembly_tag annotation 13289817 13289928 . + . Note "Single pUC clone. " CHROMOSOME_III assembly_tag annotation 13307750 13307762 . + . Note "Single pUC clone" CHROMOSOME_III assembly_tag Clone 13317580 13317583 . - . Note "left end: F53A2" CHROMOSOME_III assembly_tag Clone 13317580 13317583 . - . Note "left end: F53A2" CHROMOSOME_III assembly_tag Finished 13317580 13317583 . - . Note "Left: F53A2" CHROMOSOME_III assembly_tag Clone 13317679 13317683 . + . Note "right end: Y43F4B" CHROMOSOME_III assembly_tag Finished 13317680 13317683 . + . Note "Right: Y43F4B" CHROMOSOME_III assembly_tag Finished 13360200 13360203 . + . Note "Left: Y43F4C" CHROMOSOME_III assembly_tag Clone 13360300 13360303 . + . Note "right end: F53A2" CHROMOSOME_III assembly_tag Clone 13360300 13360303 . + . Note "left end: Y43F4C" CHROMOSOME_III assembly_tag Clone 13360300 13360303 . - . Note "right end: F53A2\n" CHROMOSOME_III assembly_tag Finished 13360300 13360303 . - . Note "Right: F53A2" CHROMOSOME_III assembly_tag Clone 13361554 13361557 . - . Note "right end: Y43F4C" CHROMOSOME_III assembly_tag Clone 13361554 13361557 . - . Note "left end: left end of T03F6" CHROMOSOME_III assembly_tag Finished 13361557 13361560 . + . Note "Left: T03F6" CHROMOSOME_III assembly_tag Clone 13361557 13361560 . + . Note "left end: T03F6" CHROMOSOME_III assembly_tag Finished 13361654 13361657 . + . Note "Right: Y43F4C" CHROMOSOME_III assembly_tag Finished 13396007 13396010 . + . Note "Left: F11F1" CHROMOSOME_III assembly_tag Clone 13396107 13396110 . - . Note "right end: END OF T03F6" CHROMOSOME_III assembly_tag Clone 13406009 13406012 . + . Note "left end: F45G2" CHROMOSOME_III assembly_tag Clone 13406009 13406012 . + . Note "left end: F45G2" CHROMOSOME_III assembly_tag Finished 13406009 13406012 . + . Note "Left: F45G2" CHROMOSOME_III assembly_tag Finished 13406109 13406112 . + . Note "Right: F11F1" CHROMOSOME_III assembly_tag Clone 13430168 13430171 . + . Note "right end: end of F11F1" CHROMOSOME_III assembly_tag Finished 13442213 13442216 . + . Note "Left: Y76A2A" CHROMOSOME_III assembly_tag Finished 13442314 13442317 . + . Note "Right: F45G2" CHROMOSOME_III assembly_tag Clone 13442314 13442317 . + . Note "right end: F45G2" CHROMOSOME_III assembly_tag Clone 13442314 13442317 . + . Note "right end: F45G2" CHROMOSOME_III assembly_tag annotation 13446486 13448018 . + . Note "[X] Tandem repeat \n[ ] Single clone region \n[ ] Forced join \n[ ] Other \nComment\n" CHROMOSOME_III assembly_tag annotation 13447292 13447312 . + . Note "[ ] Tandem repeat \n[ ] Single clone region \n[X] Forced join \n[ ] Other \nComment\n" CHROMOSOME_III assembly_tag annotation 13450772 13450787 . + . Note "First select a Feature -\n[] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSingle stranded primer in loop of inverted\nrepeat\n\n\n\n" CHROMOSOME_III assembly_tag Clone 13461401 13461404 . + . Note "left end: T27E9" CHROMOSOME_III assembly_tag Clone 13461401 13461404 . + . Note "left end: T27E9" CHROMOSOME_III assembly_tag Finished 13461401 13461404 . + . Note "Left: T27E9" CHROMOSOME_III assembly_tag Finished 13461501 13461504 . + . Note "Right: Y76A2A" CHROMOSOME_III assembly_tag Finished 13483542 13483545 . + . Note "Left: T28A8" CHROMOSOME_III assembly_tag Clone 13483542 13483545 . + . Note "left end: T28A8" CHROMOSOME_III assembly_tag Clone 13483542 13483545 . - . Note "left end: T28A8" CHROMOSOME_III assembly_tag Finished 13483642 13483645 . + . Note "Right: T27E9" CHROMOSOME_III assembly_tag Clone 13498202 13498207 . + . Note "right end: Y43F4" CHROMOSOME_III assembly_tag Clone 13500468 13500471 . + . Note "right end: T27E9" CHROMOSOME_III assembly_tag Finished 13517826 13517829 . + . Note "Left: Y76A2B " CHROMOSOME_III assembly_tag Clone 13517926 13517929 . + . Note "right end: T28A8" CHROMOSOME_III assembly_tag Clone 13517926 13517929 . + . Note "right end: T28A8" CHROMOSOME_III assembly_tag Finished 13517926 13517929 . + . Note "Right: T28A8" CHROMOSOME_III assembly_tag Clone 13553592 13553595 . + . Note "left end: T05D4 - this could be the right hand \nend as there is no overlap info\n(27-7-96)" CHROMOSOME_III assembly_tag Finished 13553592 13553595 . + . Note "Left: T05D4" CHROMOSOME_III assembly_tag Clone 13553592 13553595 . + . Note "left end: T05D4" CHROMOSOME_III assembly_tag Finished 13553692 13553695 . + . Note "Right: Y76A2B" CHROMOSOME_III assembly_tag annotation 13576122 13576124 . + . Note "probably TTAT" CHROMOSOME_III assembly_tag annotation 13583763 13586203 . + . Note "tandem repeat, not fully finished\n\npredominant element \n34mer eg TTTTTCCGCAAGTACATTTTTCCGCCGGTTTGAG\n\nlength to end of cosmid ~3160 by restriction digest" CHROMOSOME_III assembly_tag Clone 13586200 13586203 . + . Note "right end: T05D4 - this could be the left end as\nthere is no overlap data (27-7-96)." CHROMOSOME_III assembly_tag Finished 13586200 13586203 . + . Note "Right: T05D4" CHROMOSOME_III assembly_tag Finished 13602506 13602509 . + . Note "Left: T25C8" CHROMOSOME_III assembly_tag Clone 13602506 13602509 . + . Note "left end: Beginning of T25C8" CHROMOSOME_III assembly_tag Clone 13618003 13618006 . + . Note "left end: T12D8" CHROMOSOME_III assembly_tag Finished 13618003 13618006 . + . Note "Left: T12D8" CHROMOSOME_III assembly_tag Clone 13618003 13618006 . + . Note "left end: Beginning of T12D8" CHROMOSOME_III assembly_tag Finished 13618103 13618106 . + . Note "Right: T25C8" CHROMOSOME_III assembly_tag Clone 13634954 13634957 . + . Note "right end: End of T25C8" CHROMOSOME_III assembly_tag Finished 13655255 13655258 . + . Note "Left: ZK525" CHROMOSOME_III assembly_tag Clone 13655352 13655355 . + . Note "right end: T12D8" CHROMOSOME_III assembly_tag Finished 13655352 13655355 . + . Note "Right: T12D8" CHROMOSOME_III assembly_tag Clone 13655352 13655355 . + . Note "right end: T12D8" CHROMOSOME_III assembly_tag annotation 13663786 13663790 . + . Note "Tn1000 transposon has been removed from here." CHROMOSOME_III assembly_tag Clone 13675520 13675523 . + . Note "left end: ZK520" CHROMOSOME_III assembly_tag Finished 13675520 13675523 . + . Note "Left: " CHROMOSOME_III assembly_tag Clone 13675520 13675523 . - . Note "left end: ZK520" CHROMOSOME_III assembly_tag Finished 13675620 13675623 . + . Note "Right: ZK525" CHROMOSOME_III assembly_tag Clone 13681022 13681025 . - . Note "right end: ZK525" CHROMOSOME_III assembly_tag Clone 13710770 13710773 . + . Note "left end: W06F12" CHROMOSOME_III assembly_tag Clone 13710770 13710773 . + . Note "left end: BEGINNING OF W06F12" CHROMOSOME_III assembly_tag Finished 13710770 13710773 . + . Note "Left: W06F12" CHROMOSOME_III assembly_tag Finished 13710870 13710873 . + . Note "Right: " CHROMOSOME_III assembly_tag Finished 13740185 13740188 . + . Note "Left: K08E3" CHROMOSOME_III assembly_tag Clone 13740185 13740188 . + . Note "left end: K08E3" CHROMOSOME_III assembly_tag cosmid 13740185 13740188 . + . Note "vector: CAF:END=Left::loristB" CHROMOSOME_III assembly_tag Clone 13740185 13740188 . + . Note "left end: Beginning of K08E3" CHROMOSOME_III assembly_tag cosmid 13740185 13740188 . - . Note "vector: CAF:END=Left::loristB" CHROMOSOME_III assembly_tag Finished 13740286 13740289 . + . Note "Right: W06F12" CHROMOSOME_III assembly_tag Clone 13740648 13740651 . + . Note "right end: W06F12" CHROMOSOME_III assembly_tag repeat 13748402 13749701 . + . CHROMOSOME_III assembly_tag annotation 13749707 13750528 . + . Note "tandem repeat region with typical repeat\nelement GAGACTTTCGTGGTGAGACCTTTGTGGT (a\n28-mer). Restriction digest shows that\n130 bases of repeat region are missing\nfrom this assembly." CHROMOSOME_III assembly_tag repeat 13752474 13753243 . + . CHROMOSOME_III assembly_tag repeat 13753255 13754323 . + . CHROMOSOME_III assembly_tag Inverted 13774860 13775632 . - . Note "Repeat: " CHROMOSOME_III assembly_tag Inverted 13775703 13776496 . + . Note "Repeat: " CHROMOSOME_III assembly_tag Inverted 13778974 13779080 . - . Note "Repeat: " CHROMOSOME_III assembly_tag annotation 13779502 13779596 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -single pUC18 clone in inverted repeatregion. Size of the region is confirmedby restriction digest" CHROMOSOME_III assembly_tag Inverted 13779558 13779664 . + . Note "Repeat: " CHROMOSOME_III assembly_tag Finished 13779698 13779701 . + . Note "Left: 3R5" CHROMOSOME_III assembly_tag Clone 13779746 13779749 . + . Note "right end: K08E3" CHROMOSOME_III assembly_tag Finished 13779746 13779749 . + . Note "Right: K08E3" CHROMOSOME_III assembly_tag Clone 13779746 13779749 . + . Note "right end: K08E3" CHROMOSOME_III assembly_tag cosmid 13779746 13779749 . + . Note "vector: CAF:END=Right::loristB" CHROMOSOME_III assembly_tag cosmid 13779746 13779749 . - . Note "vector: CAF:END=Right::loristB" CHROMOSOME_III assembly_tag annotation 13780417 13780451 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only by a single subclone which has been sequenced with both primer and terminator chemistries. Subclone is taken from a library made from a pcr product, the overall assembly is consistent with the size of the product when run on a gel." CHROMOSOME_III assembly_tag Finished 13782337 13782342 . + . Note "Left: cTel5" CHROMOSOME_III assembly_tag Finished 13782392 13782395 . + . Note "Right: 3R5" CHROMOSOME_III assembly_tag Finished 13783264 13783268 . + . Note "Right: cTel5" CHROMOSOME_III GenePair_STS structural 1 2127 . + . PCR_product "smd_Y55B1A_115.d" CHROMOSOME_III Genomic_canonical Sequence 1 4006 . + . Sequence "cTel54X" CHROMOSOME_III Homol_data 1 4006 . + . Homol_data "cTel54X:wublastx_yeast" CHROMOSOME_III Homol_data 1 4006 . + . Homol_data "cTel54X:wublastx_slimSwissProt" CHROMOSOME_III Homol_data 1 4006 . + . Homol_data "cTel54X:wublastx_worm" CHROMOSOME_III Homol_data 1 4006 . + . Homol_data "cTel54X:wublastx_slimTrEMBL" CHROMOSOME_III Homol_data 1 4006 . + . Homol_data "cTel54X:wublastx_human" CHROMOSOME_III Homol_data 1 4006 . + . Homol_data "cTel54X:wublastx_fly" CHROMOSOME_III Homol_data 1 150000 . + . Homol_data "BLAT_EMBL:SUPERLINK_RW3A_1" CHROMOSOME_III Homol_data 1 150000 . + . Homol_data "BLAT_EST:SUPERLINK_RW3A_1" CHROMOSOME_III Homol_data 1 150000 . + . Homol_data "BLATX_NEMATODE:SUPERLINK_RW3A_1" CHROMOSOME_III Homol_data 1 150000 . + . Homol_data "BLAT_mRNA:SUPERLINK_RW3A_1" CHROMOSOME_III Feature_data 1 150000 . + . Feature_data "Confirmed_intron_EMBL:SUPERLINK_RW3A_1" CHROMOSOME_III Feature_data 1 150000 . + . Feature_data "Confirmed_intron_mRNA:SUPERLINK_RW3A_1" CHROMOSOME_III Feature_data 1 150000 . + . Feature_data "Confirmed_intron_EST:SUPERLINK_RW3A_1" CHROMOSOME_III Link Sequence 1 3339160 . + . Sequence "SUPERLINK_RW3A" CHROMOSOME_III Link Sequence 1 13783268 . + . Sequence "CHROMOSOME_III" CHROMOSOME_III GenePair_STS structural 1059 2254 . + . PCR_product "sjj_cTel54X.1" CHROMOSOME_III RNAi experimental 1059 2254 . + . RNAi "JA:cTel54X.1" CHROMOSOME_III GenePair_STS structural 1059 2254 . + . PCR_product "mv_cTel54X.1" CHROMOSOME_III Microarray_aff 1271 1921 . + . Microarray_aff "Aff_CTEL54X.A" CHROMOSOME_III Homol_data 3907 35782 . + . Homol_data "H10E21:wublastx_worm" CHROMOSOME_III Genomic_canonical Sequence 3907 35782 . + . Sequence "H10E21" CHROMOSOME_III Homol_data 3907 35782 . + . Homol_data "H10E21:wublastx_slimSwissProt" CHROMOSOME_III Homol_data 3907 35782 . + . Homol_data "H10E21:waba" CHROMOSOME_III Homol_data 3907 35782 . + . Homol_data "H10E21:wublastx_human" CHROMOSOME_III Homol_data 3907 35782 . + . Homol_data "H10E21:wublastx_slimTrEMBL" CHROMOSOME_III Homol_data 3907 35782 . + . Homol_data "H10E21:wublastx_fly" CHROMOSOME_III Homol_data 3907 35782 . + . Homol_data "H10E21:wublastx_yeast" CHROMOSOME_III curated Sequence 8856 11940 . + . Sequence "H10E21.2" CHROMOSOME_III RNAi experimental 9773 11076 . + . RNAi "TH:327F11" CHROMOSOME_III GenePair_STS structural 9773 11076 . + . PCR_product "TH:327F11" CHROMOSOME_III GenePair_STS structural 9892 11096 . + . PCR_product "TH:340C7" CHROMOSOME_III RNAi experimental 9892 11096 . + . RNAi "TH:340C7" CHROMOSOME_III Expr_profile Expression 10826 13068 . + . Expr_profile "H10E21.2" CHROMOSOME_III GenePair_STS structural 10826 13068 . + . PCR_product "mv_H10E21.2" CHROMOSOME_III GenePair_STS structural 10826 13068 . + . PCR_product "sjj_H10E21.2" CHROMOSOME_III Microarray_aff 11057 12549 . + . Microarray_aff "Aff_H10E21.2" CHROMOSOME_III RNAi experimental 11826 13152 . + . RNAi "TH:327E8" CHROMOSOME_III Microarray_aff 12189 13200 . + . Microarray_aff "Aff_H10E21.3" CHROMOSOME_III GenePair_STS structural 13103 14054 . + . PCR_product "mv_H10E21.3" CHROMOSOME_III Expr_profile Expression 13103 14054 . + . Expr_profile "H10E21.3" CHROMOSOME_III GenePair_STS structural 13103 14054 . + . PCR_product "sjj_H10E21.3" CHROMOSOME_III RNAi experimental 13103 14054 . + . RNAi "JA:H10E21.3" CHROMOSOME_III RNAi experimental 13508 14730 . + . RNAi "TH:340E12" CHROMOSOME_III Expr_profile Expression 15681 17220 . + . Expr_profile "H10E21.1" CHROMOSOME_III RNAi experimental 15681 17220 . + . RNAi "JA:H10E21.1" CHROMOSOME_III GenePair_STS structural 15681 17220 . + . PCR_product "sjj_H10E21.1" CHROMOSOME_III GenePair_STS structural 15681 17220 . + . PCR_product "mv_H10E21.1" CHROMOSOME_III RNAi experimental 15737 17234 . + . RNAi "TH:327E11" CHROMOSOME_III GenePair_STS structural 15737 17234 . + . PCR_product "TH:327E11" CHROMOSOME_III Microarray_aff 16080 17280 . + . Microarray_aff "Aff_H10E21.1" CHROMOSOME_III UTR UTR 16180 16806 . + . UTR "5_UTR:H10E21.1" CHROMOSOME_III curated Sequence 16807 17279 . + . Sequence "H10E21.1" CHROMOSOME_III cDNA_for_RNAi experimental 17395 19570 . + . Sequence "yk387f12" CHROMOSOME_III RNAi experimental 17395 19570 . + . RNAi "SA:yk387f12" CHROMOSOME_III Microarray_aff 17421 19395 . + . Microarray_aff "Aff_H10E21.4" CHROMOSOME_III GenePair_STS structural 17424 19657 . + . PCR_product "sjj_H10E21.4" CHROMOSOME_III RNAi experimental 17424 19657 . + . RNAi "JA:H10E21.4" CHROMOSOME_III GenePair_STS structural 17424 19657 . + . PCR_product "mv_H10E21.4" CHROMOSOME_III RNAi experimental 17493 19431 . + . RNAi "TH:334G6" CHROMOSOME_III GenePair_STS structural 17493 19431 . + . PCR_product "TH:334G6" CHROMOSOME_III Microarray_aff 20755 21709 . + . Microarray_aff "Aff_H10E21.5" CHROMOSOME_III RNAi experimental 20974 21934 . + . RNAi "TH:327B5" CHROMOSOME_III GenePair_STS structural 20974 21934 . + . PCR_product "TH:327B5" CHROMOSOME_III GenePair_STS structural 22560 23935 . + . PCR_product "mv_H10E21.5" CHROMOSOME_III RNAi experimental 22560 23935 . + . RNAi "JA:H10E21.5" CHROMOSOME_III Expr_profile Expression 22560 23935 . + . Expr_profile "H10E21.5" CHROMOSOME_III GenePair_STS structural 22560 23935 . + . PCR_product "sjj_H10E21.5" CHROMOSOME_III GenePair_STS structural 31611 32588 . + . PCR_product "TH:328D1" CHROMOSOME_III RNAi experimental 31611 32588 . + . RNAi "TH:328D1" CHROMOSOME_III Genomic_canonical Sequence 35583 66295 . + . Sequence "W05G11" CHROMOSOME_III Homol_data 35583 66295 . + . Homol_data "W05G11:wublastx_yeast" CHROMOSOME_III Homol_data 35583 66295 . + . Homol_data "W05G11:wublastx_worm" CHROMOSOME_III Homol_data 35583 66295 . + . Homol_data "W05G11:waba" CHROMOSOME_III Homol_data 35583 66295 . + . Homol_data "W05G11:wublastx_slimSwissProt" CHROMOSOME_III Homol_data 35583 66295 . + . Homol_data "W05G11:wublastx_slimTrEMBL" CHROMOSOME_III Homol_data 35583 66295 . + . Homol_data "W05G11:wublastx_fly" CHROMOSOME_III Homol_data 35583 66295 . + . Homol_data "W05G11:wublastx_human" CHROMOSOME_III Microarray_aff 35650 36346 . + . Microarray_aff "Aff_W05G11.4" CHROMOSOME_III GenePair_STS structural 37074 38187 . + . PCR_product "mv_W05G11.4" CHROMOSOME_III Expr_profile Expression 37074 38187 . + . Expr_profile "W05G11.4" CHROMOSOME_III GenePair_STS structural 37074 38187 . + . PCR_product "sjj_W05G11.4" CHROMOSOME_III RNAi experimental 37074 38187 . + . RNAi "JA:W05G11.4" CHROMOSOME_III RNAi experimental 40787 42268 . + . RNAi "TH:328C10" CHROMOSOME_III GenePair_STS structural 40787 42268 . + . PCR_product "TH:328C10" CHROMOSOME_III curated Sequence 41062 41970 . + . Sequence "W05G11.3" CHROMOSOME_III RNAi experimental 41084 41950 . + . RNAi "SA:yk254c9" CHROMOSOME_III cDNA_for_RNAi experimental 41084 41950 . + . Sequence "yk254c9" CHROMOSOME_III GenePair_STS structural 41098 42269 . + . PCR_product "sjj_W05G11.3" CHROMOSOME_III Expr_profile Expression 41098 42269 . + . Expr_profile "W05G11.3" CHROMOSOME_III Microarray_aff 41371 41971 . + . Microarray_aff "Aff_W05G11.3" CHROMOSOME_III GenePair_STS structural 46670 48150 . + . PCR_product "smd_Y53G8B_93.e" CHROMOSOME_III GenePair_STS structural 57458 58772 . + . PCR_product "smd_W05G11.2" CHROMOSOME_III RNAi experimental 57458 58772 . + . RNAi "JA:W05G11.2" CHROMOSOME_III Expr_profile Expression 57458 58772 . + . Expr_profile "W05G11.2" CHROMOSOME_III GenePair_STS structural 57458 58772 . + . PCR_product "sjj_W05G11.2" CHROMOSOME_III GenePair_STS structural 57458 58772 . + . PCR_product "mv_W05G11.2" CHROMOSOME_III curated Sequence 57481 58681 . + . Sequence "W05G11.2" CHROMOSOME_III RNAi experimental 57483 58334 . + . RNAi "TH:341B1" CHROMOSOME_III GenePair_STS structural 57483 58334 . + . PCR_product "TH:341B1" CHROMOSOME_III GenePair_STS structural 57489 58956 . + . PCR_product "TH:335C11" CHROMOSOME_III RNAi experimental 57489 58956 . + . RNAi "TH:335C11" CHROMOSOME_III Microarray_aff 57680 58682 . + . Microarray_aff "Aff_W05G11.2" CHROMOSOME_III Expr_profile Expression 59216 60873 . + . Expr_profile "W05G11.5" CHROMOSOME_III GenePair_STS structural 59216 60873 . + . PCR_product "mv_W05G11.5" CHROMOSOME_III RNAi experimental 59216 60873 . + . RNAi "JA:W05G11.5" CHROMOSOME_III GenePair_STS structural 59216 60873 . + . PCR_product "smd_W05G11.5" CHROMOSOME_III GenePair_STS structural 59216 60873 . + . PCR_product "sjj_W05G11.5" CHROMOSOME_III Microarray_aff 59371 60519 . + . Microarray_aff "Aff_W05G11.5" CHROMOSOME_III GenePair_STS structural 59622 60872 . + . PCR_product "TH:328D10" CHROMOSOME_III RNAi experimental 59622 60872 . + . RNAi "TH:328D10" CHROMOSOME_III GenePair_STS structural 62848 63966 . + . PCR_product "sjj_W05G11.6" CHROMOSOME_III Expr_profile Expression 62848 63966 . + . Expr_profile "W05G11.6" CHROMOSOME_III RNAi experimental 62848 63966 . + . RNAi "JA:W05G11.6" CHROMOSOME_III GenePair_STS structural 62848 63966 . + . PCR_product "mv_W05G11.6" CHROMOSOME_III cDNA_for_RNAi experimental 62947 66235 . + . Sequence "yk373g10" CHROMOSOME_III RNAi experimental 62947 66235 . + . RNAi "SA:yk373g10" CHROMOSOME_III Microarray_aff 62988 63723 . + . Microarray_aff "Aff_W05G11.6" CHROMOSOME_III GenePair_STS structural 63398 65053 . + . PCR_product "smd_W05G11.6" CHROMOSOME_III GenePair_STS structural 63559 65052 . + . PCR_product "TH:326C11" CHROMOSOME_III RNAi experimental 63559 65052 . + . RNAi "TH:326C11" CHROMOSOME_III Homol_data 64786 92285 . + . Homol_data "F54C4:wublastx_worm" CHROMOSOME_III Homol_data 64786 92285 . + . Homol_data "F54C4:wublastx_fly" CHROMOSOME_III Homol_data 64786 92285 . + . Homol_data "F54C4:wublastx_yeast" CHROMOSOME_III Homol_data 64786 92285 . + . Homol_data "F54C4:wublastx_human" CHROMOSOME_III Genomic_canonical Sequence 64786 92285 . + . Sequence "F54C4" CHROMOSOME_III Homol_data 64786 92285 . + . Homol_data "F54C4:wublastx_slimSwissProt" CHROMOSOME_III Homol_data 64786 92285 . + . Homol_data "F54C4:wublastx_slimTrEMBL" CHROMOSOME_III Homol_data 64786 92285 . + . Homol_data "F54C4:waba" CHROMOSOME_III RNAi experimental 68573 69745 . + . RNAi "TH:326E11" CHROMOSOME_III GenePair_STS structural 68573 69745 . + . PCR_product "TH:326E11" CHROMOSOME_III GenePair_STS structural 68628 69765 . + . PCR_product "sjj_F54C4.2" CHROMOSOME_III RNAi experimental 68628 69765 . + . RNAi "JA:F54C4.2" CHROMOSOME_III Expr_profile Expression 68628 69765 . + . Expr_profile "F54C4.2" CHROMOSOME_III GenePair_STS structural 69032 70027 . + . PCR_product "smd_F54C4.2" CHROMOSOME_III Microarray_aff 69225 69738 . + . Microarray_aff "Aff_F54C4.2" CHROMOSOME_III Microarray_aff 70527 73648 . + . Microarray_aff "Aff_F54C4.3" CHROMOSOME_III RNAi experimental 84287 86504 . + . RNAi "JA:F54C4.3" CHROMOSOME_III GenePair_STS structural 84287 86504 . + . PCR_product "sjj_F54C4.3" CHROMOSOME_III Expr_profile Expression 84287 86504 . + . Expr_profile "F54C4.3" CHROMOSOME_III GenePair_STS structural 84287 86504 . + . PCR_product "mv_F54C4.3" CHROMOSOME_III RNAi experimental 85757 86456 . + . RNAi "TH:327C11" CHROMOSOME_III RNAi experimental 85801 86343 . + . RNAi "TH:340D11" CHROMOSOME_III RNAi experimental 86440 87338 . + . RNAi "TH:330C1" CHROMOSOME_III GenePair_STS structural 86440 87338 . + . PCR_product "TH:330C1" CHROMOSOME_III Expr_profile Expression 86482 87392 . + . Expr_profile "F54C4.4" CHROMOSOME_III GenePair_STS structural 86482 87392 . + . PCR_product "sjj_F54C4.4" CHROMOSOME_III GenePair_STS structural 86482 87392 . + . PCR_product "mv_F54C4.4" CHROMOSOME_III RNAi experimental 86482 87392 . + . RNAi "JA:F54C4.4" CHROMOSOME_III Microarray_aff 86779 87259 . + . Microarray_aff "Aff_F54C4.4" CHROMOSOME_III GenePair_STS structural 87534 89224 . + . PCR_product "mv_F54C4.1" CHROMOSOME_III GenePair_STS structural 87534 89224 . + . PCR_product "sjj_F54C4.1" CHROMOSOME_III Expr_profile Expression 87534 89224 . + . Expr_profile "F54C4.1" CHROMOSOME_III RNAi experimental 87534 89224 . + . RNAi "JA:F54C4.1" CHROMOSOME_III UTR UTR 87557 87562 . + . UTR "5_UTR:F54C4.1" CHROMOSOME_III curated Sequence 87563 89151 . + . Sequence "F54C4.1" CHROMOSOME_III Microarray_aff 87563 89152 . + . Microarray_aff "Aff_F54C4.1" CHROMOSOME_III RNAi experimental 87621 89285 . + . RNAi "TH:329D10" CHROMOSOME_III GenePair_STS structural 87621 89285 . + . PCR_product "TH:329D10" CHROMOSOME_III UTR UTR 89152 89229 . + . UTR "3_UTR:F54C4.1" CHROMOSOME_III GenePair_STS structural 89525 91902 . + . PCR_product "sjj_C29F9.7" CHROMOSOME_III Expr_profile Expression 89525 91902 . + . Expr_profile "C29F9.7" CHROMOSOME_III GenePair_STS structural 89525 91902 . + . PCR_product "mv_C29F9.7" CHROMOSOME_III RNAi experimental 89525 91902 . + . RNAi "JA:C29F9.7" CHROMOSOME_III Homol_data 89636 136231 . + . Homol_data "C29F9:wublastx_worm" CHROMOSOME_III Homol_data 89636 136231 . + . Homol_data "C29F9:wublastx_slimSwissProt" CHROMOSOME_III Homol_data 89636 136231 . + . Homol_data "C29F9:waba" CHROMOSOME_III Genomic_canonical Sequence 89636 136231 . + . Sequence "C29F9" CHROMOSOME_III Homol_data 89636 136231 . + . Homol_data "C29F9:wublastx_yeast" CHROMOSOME_III Homol_data 89636 136231 . + . Homol_data "C29F9:wublastx_fly" CHROMOSOME_III Homol_data 89636 136231 . + . Homol_data "C29F9:wublastx_slimTrEMBL" CHROMOSOME_III Homol_data 89636 136231 . + . Homol_data "C29F9:wublastx_human" CHROMOSOME_III Microarray_aff 89642 91706 . + . Microarray_aff "Aff_C29F9.7" CHROMOSOME_III RNAi experimental 89887 92167 . + . RNAi "TH:335E12" CHROMOSOME_III Microarray_aff 95393 97520 . + . Microarray_aff "Aff_C29F9.8" CHROMOSOME_III GenePair_STS structural 95485 97769 . + . PCR_product "sjj_C29F9.8" CHROMOSOME_III RNAi experimental 95485 97769 . + . RNAi "JA:C29F9.8" CHROMOSOME_III Expr_profile Expression 95485 97769 . + . Expr_profile "C29F9.8" CHROMOSO