##gff-version 2 ##date 2001-04-10 ##sequence-region CHROMOSOME_III 1 13841722 CHROMOSOME_III assembly_tag Finished 1311280 1311283 . - . Note "Left: ZC47" CHROMOSOME_III assembly_tag Clone 1311383 1311388 . + . Note "right end: Y119D3" CHROMOSOME_III assembly_tag annotation 1329764 1329767 . - . Note "not sure if this is TTGG or TTTG" CHROMOSOME_III assembly_tag Clone 1337621 1337626 . - . Note "right end: ZC47" CHROMOSOME_III assembly_tag Finished 1337621 1337626 . - . Note "Right: ZC47" CHROMOSOME_III assembly_tag final 3385225 3385228 . + . Note "annotation: beginning of F45H7" CHROMOSOME_III assembly_tag final 3407319 3407323 . + . Note "annotation: probable beginning of C56G7" CHROMOSOME_III assembly_tag final 3424500 3424503 . + . Note "annotation: end of F45H7" CHROMOSOME_III assembly_tag annotation 3424500 3424503 . + . Note "end of F45H7 start of C56G7" CHROMOSOME_III assembly_tag annotation 3424500 3424503 . + . Note "TRUE START ON F45H7" CHROMOSOME_III assembly_tag annotation 3424500 3424503 . + . Note "C56G7 JUST ITS FINISHING" CHROMOSOME_III assembly_tag annotation 3424500 3424503 . + . Note "THIS IS NOT THE BEGINNING OF " CHROMOSOME_III assembly_tag annotation 3424500 3424503 . + . Note "start of C56G7" CHROMOSOME_III assembly_tag annotation 3424972 3424987 . + . Note "number of T's not 100% certain but spacing suggests 6." CHROMOSOME_III assembly_tag annotation 3431092 3431102 . + . Note "Problem repeat area between 620 and 8850 21 copies of a 95bp repeat element. where data is weak, the sequence has been edited with the help of the repeatconsensus. The assembly is correct according to differences between individual copies of the repeat. The total size of repeat agrees with pcr from cosmid and genomic DNA So, to the best of our knowledge this is correct, but beware!" CHROMOSOME_III assembly_tag annotation 3431135 3431136 . + . Note "point mutation of T to C at this point on single strand only." CHROMOSOME_III assembly_tag annotation 3431176 3431189 . + . Note "Compression resolved only on negative strand other versions read GAGGGCC" CHROMOSOME_III assembly_tag annotation 3431271 3431282 . + . Note "Compression resolved on one strand only" CHROMOSOME_III assembly_tag annotation 3431289 3431291 . + . Note "Majority of reads are CAC with a single read ambigous" CHROMOSOME_III assembly_tag annotation 3431318 3431318 . + . Note "could well be T, go with the consensus" CHROMOSOME_III assembly_tag annotation 3431330 3431330 . + . Note "edit to consensus" CHROMOSOME_III assembly_tag annotation 3431359 3431385 . + . Note "compression resolved on one strand only" CHROMOSOME_III assembly_tag annotation 3431457 3431482 . + . Note "compression resolved on one strand only" CHROMOSOME_III assembly_tag annotation 3431554 3431569 . + . Note "Hairpin GGGCC-loop-GGCCC loop is probably GCA but resolution may not be complete despit the terminator" CHROMOSOME_III assembly_tag annotation 3431649 3431667 . + . Note "Difficult hairpin repeat Sequence uncertain" CHROMOSOME_III assembly_tag annotation 3431711 3431712 . + . Note "Ambigous base but repeat consenus suggests an A" CHROMOSOME_III assembly_tag annotation 3431735 3431737 . + . Note "variable region in the repeat may be either T or C" CHROMOSOME_III assembly_tag annotation 3431748 3431756 . + . Note "only postive strand but consensus agrees with previous copies" CHROMOSOME_III assembly_tag annotation 3431757 3431764 . + . Note "consensus as per normal copy but unresolved in this region " CHROMOSOME_III assembly_tag annotation 3431832 3431836 . + . Note "so0f8 repeat reads give AAG but original read and s13d11 give AGG." CHROMOSOME_III assembly_tag annotation 3431847 3431861 . + . Note "Compression edited according to repeat concensus TAC (instead of CAC) is a variation in this copy of the repeat." CHROMOSOME_III assembly_tag annotation 3431910 3431913 . + . Note "original read clearly shows CGC which is in agreement with the repeat consensus terminator read shows CGG. " CHROMOSOME_III assembly_tag annotation 3432581 3432587 . + . Note "edited GCCTAC according to consensus" CHROMOSOME_III assembly_tag annotation 3432819 3432826 . + . Note "probably CTAA" CHROMOSOME_III assembly_tag annotation 3432985 3433028 . + . Note "single stranded region with terminator across it" CHROMOSOME_III assembly_tag annotation 3432993 3433002 . + . Note "end of problem repeat region" CHROMOSOME_III assembly_tag annotation 3433109 3433109 . + . Note "very difficult compression probably a C" CHROMOSOME_III assembly_tag annotation 3436485 3436485 . + . Note "uncertain base, probably an A" CHROMOSOME_III assembly_tag annotation 3436540 3436616 . + . Note "singlr stranded region" CHROMOSOME_III assembly_tag annotation 3436680 3436757 . + . CHROMOSOME_III assembly_tag annotation 3436757 3436833 . + . Note "single stranded region with terminators across" CHROMOSOME_III assembly_tag annotation 3436833 3436842 . + . CHROMOSOME_III assembly_tag annotation 3437026 3437026 . + . Note "pcr mutation T > c" CHROMOSOME_III assembly_tag annotation 3437375 3437392 . + . Note "Single stranded region with terminator across" CHROMOSOME_III assembly_tag annotation 3437392 3437531 . + . Note "Single stranded with terminator acroos region" CHROMOSOME_III assembly_tag annotation 3437669 3437675 . + . Note "number of A's varies between 6 and 7" CHROMOSOME_III assembly_tag annotation 3437708 3437709 . - . Note "Two traces show PCR point mutation of T to C tewlve reads show clear T" CHROMOSOME_III assembly_tag annotation 3437709 3437709 . + . Note "2/12 T to C" CHROMOSOME_III assembly_tag annotation 3438165 3438268 . + . Note "Single stranded with terminator across the region" CHROMOSOME_III assembly_tag comment 3439428 3439428 . + . Note "Begining of F59A2" CHROMOSOME_III assembly_tag repeat 3454633 3454646 . + . Note "Possible repeat for 300 bases - matches 215 889 " CHROMOSOME_III assembly_tag annotation 3457177 3457179 . + . Note "All positive and negative standard reads show three G's, as do positive terminators. Negative terminator on one read shows GAG." CHROMOSOME_III assembly_tag repeat 3458284 3458416 . + . Note "repeat unit 1" CHROMOSOME_III assembly_tag repeat 3458317 3458318 . - . CHROMOSOME_III assembly_tag repeat 3459408 3459466 . + . CHROMOSOME_III assembly_tag repeat 3459466 3459540 . + . Note "repeat unit 1" CHROMOSOME_III assembly_tag annotation 3464699 3464702 . + . Note "Beginning of K01A11" CHROMOSOME_III assembly_tag annotation 3466523 3466690 . + . Note "single-stranded with terms to check" CHROMOSOME_III assembly_tag annotation 3474523 3474622 . + . Note "Single-stranded with terms" CHROMOSOME_III assembly_tag annotation 3474623 3474760 . + . Note "Single-stranded with terms" CHROMOSOME_III assembly_tag annotation 3474761 3474934 . + . Note "Single-stranded with terms" CHROMOSOME_III assembly_tag annotation 3475883 3475886 . + . Note "right end of F59A2" CHROMOSOME_III assembly_tag annotation 3476968 3476968 . + . Note "Extra g in this sequence s28d1.s1l" CHROMOSOME_III assembly_tag annotation 3479731 3479735 . + . Note "deleted clone" CHROMOSOME_III assembly_tag annotation 3479758 3479762 . + . Note "unclear part of hairpin inverted repeat, probably 5 g's, matches 5Cs at other end of inverted repeat " CHROMOSOME_III assembly_tag annotation 3479859 3479860 . - . Note "part of inverted repeat probably a C but data is weak." CHROMOSOME_III assembly_tag annotation 3479874 3479878 . + . Note "unclear region of hairpin inverted repeat, edited to 5 c's pairs with 5gs at other end of hairpin " CHROMOSOME_III assembly_tag annotation 3488853 3488854 . + . Note "pt mutation on single read" CHROMOSOME_III assembly_tag annotation 3489684 3489684 . + . Note "Majority of reads (including terminators) read G single read gives an A here" CHROMOSOME_III assembly_tag annotation 3491099 3491099 . + . Note "marker point 1 " CHROMOSOME_III assembly_tag annotation 3491447 3491453 . + . Note "false join between 2 contigs containing repetitive sequence Distance between marker point 1 (26400) and marker point 2 (28360) should be 2.2kb according to restriction digest and pcr data. This suggests a gap of about 200bp at this point. before this point we have 2 full copies of a 120bp repeat element, with a third copy beginning This element has some homology to RcA1 The 2nd contig joins in from the beginning of this tag and contains a further 3 copies of the 120bp motif The gap probably holds 2 copies of this element, which would suggest a total of 6 copies There are then 52 copies of an 11bp motif beginning at 27350 Because of the repetitive nature of this region, some of the bases between the 2 marker points may be ambiguous. Where no base can be called, an n has been left No further work is planned on this gap" CHROMOSOME_III assembly_tag annotation 3491622 3491632 . + . Note "read may be mis-assembled" CHROMOSOME_III assembly_tag annotation 3493055 3493055 . + . Note "marker point 2" CHROMOSOME_III assembly_tag annotation 3497406 3497417 . + . Note "50 base-pair rule used here. " CHROMOSOME_III assembly_tag annotation 3498239 3498242 . + . Note "left end of C34C12" CHROMOSOME_III assembly_tag ignore 3498239 3498243 . + . Note "cutoff (cloning vector): pJB8 " CHROMOSOME_III assembly_tag ignore 3498239 3498243 . + . Note "cutoff (cloning vector): pJB8 Beginning of c34c12 (left end)." CHROMOSOME_III assembly_tag annotation 3498239 3498243 . + . Note "Begining of overlap with C34C12" CHROMOSOME_III assembly_tag ignore 3502663 3502667 . + . Note "cutoff (cloning vector): pJB8 " CHROMOSOME_III assembly_tag ignore 3502781 3502784 . + . Note "cutoff (cloning vector): ?vector" CHROMOSOME_III assembly_tag ignore 3502782 3502786 . + . Note "cutoff (cloning vector): ?vector????" CHROMOSOME_III assembly_tag ignore 3505463 3505466 . + . Note "cutoff (cloning vector): " CHROMOSOME_III assembly_tag ignore 3505667 3505670 . + . Note "cutoff (cloning vector): " CHROMOSOME_III assembly_tag ignore 3505667 3505671 . + . Note "cutoff (cloning vector): LoristB " CHROMOSOME_III assembly_tag annotation 3505673 3505676 . + . Note "end of K01A11" CHROMOSOME_III assembly_tag ignore 3509161 3509164 . + . Note "cutoff (cloning vector): " CHROMOSOME_III assembly_tag annotation 3509876 3509886 . + . Note "10 T's -best guess (could be 9-12) " CHROMOSOME_III assembly_tag annotation 3513063 3513271 . + . Note "single stranded with terminators" CHROMOSOME_III assembly_tag annotation 3513272 3513489 . + . Note "single stranded with terminators" CHROMOSOME_III assembly_tag annotation 3514137 3514157 . + . Note "single stranded with terminators" CHROMOSOME_III assembly_tag annotation 3514452 3514506 . + . Note "single stranded with terminators" CHROMOSOME_III assembly_tag annotation 3514544 3514544 . + . Note "unable to call this base terminators etc. tried." CHROMOSOME_III assembly_tag ignore 3515356 3515361 . + . Note "cutoff (cloning vector): " CHROMOSOME_III assembly_tag ignore 3526692 3526696 . + . Note "cutoff (cloning vector): pJB8 " CHROMOSOME_III assembly_tag ignore 3528133 3528137 . + . Note "cutoff (cloning vector): pJB8 " CHROMOSOME_III assembly_tag annotation 3532894 3532897 . + . Note "beginning of M01F1" CHROMOSOME_III assembly_tag annotation 3532894 3532898 . + . Note "Beginning of M01F1 @ position 9 Overlapping with C34C12" CHROMOSOME_III assembly_tag ignore 3532894 3532898 . + . Note "cutoff (cloning vector): pJB8 " CHROMOSOME_III assembly_tag annotation 3581640 3581753 . + . Note "region covered by a single read only terms and primers. All pcrs across region failed. This single read was found by screening Phagemid libraries and was the only real clone recovered" CHROMOSOME_III assembly_tag annotation 3582620 3582620 . + . Note "T has high G background on most reads but the evidence suggests the T is real" CHROMOSOME_III assembly_tag annotation 3582741 3582742 . + . Note "edited to GG. S1 reads show clear GG, but terminators call GGG. Terms do however have the spacing of 2 Gs, and none of them show 3 clear peaks, so the evidence suggests GG" CHROMOSOME_III assembly_tag annotation 3583007 3583009 . + . Note "edited to 3Cs, primer and terminator data agree with this. 2 terminator walks have the spacing of 4 Cs, but both were run on the same gel, suggesting a gel artifact." CHROMOSOME_III assembly_tag annotation 3604543 3604549 . + . Note "Start of C48D5" CHROMOSOME_III assembly_tag annotation 3611362 3611365 . + . Note "End of C54C6" CHROMOSOME_III assembly_tag annotation 3612817 3612958 . + . Note "ss with term, coming out of difficult repeat region, unable to get negative reads to work" CHROMOSOME_III assembly_tag annotation 3612888 3612888 . + . Note "Data a little messy, but this base is most probably an A." CHROMOSOME_III assembly_tag annotation 3616449 3616455 . + . Note "CTTC - Data indicates probably a T but is a bit stoppy, even with terminators." CHROMOSOME_III assembly_tag annotation 3637916 3637940 . + . Note "s84h9.s2t goes into vector just 26 bases short of area which is double stranded. Hence used the 50 b.p. rule and just put terminator, s86g4.s1t, across." CHROMOSOME_III assembly_tag annotation 3642809 3642813 . + . Note "Start of C32A3" CHROMOSOME_III assembly_tag annotation 3642811 3642814 . + . Note "beginning of C32A3" CHROMOSOME_III assembly_tag annotation 3646881 3646884 . + . Note "end of C48D5" CHROMOSOME_III assembly_tag annotation 3657298 3657344 . + . Note "doulbe-stranding failed with 4 different oligos. I have put a terminator across the other strand to check for compressions" CHROMOSOME_III assembly_tag annotation 3657395 3657408 . + . Note "sequence messy due to run of Cs, but probably correct" CHROMOSOME_III assembly_tag annotation 3657411 3657431 . + . Note "run of Gs, not double-sranded all the way aross. Number of Gs defined by Sequenase run terminators run on either side up to run of Gs" CHROMOSOME_III assembly_tag annotation 3657447 3657543 . + . Note "region to right of Gs single-stranded only, but covered with terminators, so no suspected compressions have been found" CHROMOSOME_III assembly_tag annotation 3658884 3658904 . + . Note "number of Gs unsure" CHROMOSOME_III assembly_tag annotation 3658907 3658928 . + . Note "negative strand only, but terminated to check against compressions" CHROMOSOME_III assembly_tag annotation 3662064 3662064 . + . Note "terminators on both strnds say 2 clear Cs non terminator reads call a T, but are less clear. I think CC is correct" CHROMOSOME_III assembly_tag annotation 3662605 3662605 . + . Note "point mutation of A to T on single read" CHROMOSOME_III assembly_tag annotation 3664859 3664884 . + . Note "not double-stranded through run of Cs, but terminators run to check for compressions" CHROMOSOME_III assembly_tag annotation 3670279 3670286 . + . Note "one read has this sequence deleted, It is present in all other + and - reads." CHROMOSOME_III assembly_tag annotation 3675185 3675208 . + . Note "single-stranded, but with a terminator to confirm" CHROMOSOME_III assembly_tag annotation 3678391 3678422 . + . Note "single-stranded, with terminators to solve potential compressions" CHROMOSOME_III assembly_tag annotation 3683223 3683223 . + . Note "single read has point mutation of G to T" CHROMOSOME_III assembly_tag annotation 3687964 3687970 . + . Note "?difficult region from pcrs used 'best guess' sequence" CHROMOSOME_III assembly_tag annotation 3687964 3688213 . + . Note "single-stranded" CHROMOSOME_III assembly_tag annotation 3687967 3687967 . + . Note "T > A MUTATION IN PCR FRAGMENT" CHROMOSOME_III assembly_tag annotation 3688215 3688219 . + . Note "sequence from pcr fragment. Not 100% certain over these 5 bases used best call of terminators" CHROMOSOME_III assembly_tag Finished 3688219 3688219 . + . Note "Left: " CHROMOSOME_III assembly_tag annotation 3688219 3688222 . + . Note "beginning of C46f11" CHROMOSOME_III assembly_tag Clone 3688219 3688222 . + . Note "left end: C46F11" CHROMOSOME_III assembly_tag annotation 3708750 3708750 . + . Note "dificult region where cosmid pcrs have failed. Data suggests an A, but background is high so there is some doubt" CHROMOSOME_III assembly_tag annotation 3712572 3712590 . + . Note "region that follows, represents 7 copies of a 65bp tandem repeat consensus ATTATTTTTATTCGTCTTATAATTTTAGAAAATTTTCAATAAAAATTTAAGACACTAATAAAAT We were unable to join this using just sequence data alone, and suggest this is due to variation in the consensus sequence within different clones. A phenomenon also seen in pcr across the region. Restrition digest data suggests a 3.2 bp band between 2 flanking StuI sites, so the 2 contigs have been joined and the data edited to a consensus over this region." CHROMOSOME_III assembly_tag annotation 3712956 3712956 . + . Note "probablyA part of tandem repeat" CHROMOSOME_III assembly_tag Clone 3713760 3713763 . + . Note "left end: T27D1" CHROMOSOME_III assembly_tag Finished 3713864 3713864 . + . Note "Right: " CHROMOSOME_III assembly_tag annotation 3722958 3722961 . + . Note "Beginning of T27D1 edit @ position 14774. End of C46F11 edit. End of C46F11 @ postion 22947. " CHROMOSOME_III assembly_tag annotation 3722958 3722961 . + . Note "Beginning of T27D1 edit. " CHROMOSOME_III assembly_tag annotation 3726058 3726058 . + . Note "Point mutation on single PCR clone. A changed to a G" CHROMOSOME_III assembly_tag annotation 3726065 3726065 . + . Note "Point mutation on single PCR clone. T changed to C" CHROMOSOME_III assembly_tag annotation 3726103 3726103 . + . Note "Point mutation on a single PCR clone. T changed to a G " CHROMOSOME_III assembly_tag annotation 3726146 3726146 . + . Note "Point mutation on a single PCR clone. A changed to a T" CHROMOSOME_III assembly_tag annotation 3726154 3726154 . + . Note "Point muation on a single PCR clone. G changed to an A" CHROMOSOME_III assembly_tag annotation 3726236 3726237 . - . Note "Single PCR clone has ten T's. Consesus has nine " CHROMOSOME_III assembly_tag annotation 3726236 3726237 . - . Note "Single PCR clone has ten T's. Consensus has nine T's." CHROMOSOME_III assembly_tag annotation 3726237 3726237 . + . Note "Single PCR clone has ten T's. The consensus has nine T's." CHROMOSOME_III assembly_tag annotation 3726238 3726238 . + . Note "Point mutation on a single PCR clone. T changed to an A" CHROMOSOME_III assembly_tag annotation 3726308 3726308 . + . Note "Point mutation on a single PCR clone. A changed to G" CHROMOSOME_III assembly_tag annotation 3726315 3726315 . + . Note "Point muation on asingle PCR clone. G changed to an A" CHROMOSOME_III assembly_tag annotation 3726367 3726367 . + . Note "Point mutation on a single PCR clone. T changed to a G" CHROMOSOME_III assembly_tag annotation 3726396 3726396 . + . Note "Point muation on a single PCR clone T changed to an A" CHROMOSOME_III assembly_tag annotation 3726404 3726404 . + . Note "Point muation on a single PCR clone T changed to a C" CHROMOSOME_III assembly_tag annotation 3726426 3726426 . + . Note "Single PCR clone has eight A's. The consensus has seven A's." CHROMOSOME_III assembly_tag annotation 3726441 3726441 . + . Note "Point mutation on a single PCR clone A changed to G" CHROMOSOME_III assembly_tag annotation 3726448 3726448 . + . Note "Point mutation on single PCR clone A changed to a G" CHROMOSOME_III assembly_tag annotation 3726480 3726480 . + . Note "point mutation on single PCR clone T changed to C" CHROMOSOME_III assembly_tag annotation 3726522 3726522 . + . Note "Point mutation on single PCR clone T changed to C " CHROMOSOME_III assembly_tag annotation 3726560 3726560 . + . Note "Point mutatiopn on a single PCR clone. A changed to a G." CHROMOSOME_III assembly_tag annotation 3726562 3726562 . + . Note "Point mutation on a single PCR clone. A changed to a T" CHROMOSOME_III assembly_tag annotation 3726755 3726755 . + . Note "point mutation on a single PCR clone. G changed to an A." CHROMOSOME_III assembly_tag annotation 3726758 3726758 . + . Note "Point mutation on a single PCR clone. T changed to a C" CHROMOSOME_III assembly_tag annotation 3726854 3726854 . + . Note "Point mutation on PCR clone T changed to a C" CHROMOSOME_III assembly_tag annotation 3726864 3726864 . + . Note "Point mutation on single PCR clone. T changed to an A" CHROMOSOME_III assembly_tag annotation 3726899 3726899 . + . Note "Point mutation on single PCR clone A changed to a G" CHROMOSOME_III assembly_tag annotation 3726910 3726910 . + . Note "Point mutation on a single PCR clone. G changed to an A" CHROMOSOME_III assembly_tag annotation 3727075 3727083 . + . Note "2 reads (one walk, one pcr product) read GAAGA to the left of this sequence then go into vector" CHROMOSOME_III assembly_tag annotation 3727133 3727133 . + . Note "Point mutation on a single PCR clone. A changed to a T" CHROMOSOME_III assembly_tag annotation 3727340 3727340 . + . Note "Point mutation on a single PCR clone. A changed to a G" CHROMOSOME_III assembly_tag annotation 3727434 3727434 . + . Note "Point mutation on single PCR clone. A changed to a G" CHROMOSOME_III assembly_tag annotation 3727486 3727486 . + . Note "Point mutation on a single PCR clone A changed to a G" CHROMOSOME_III assembly_tag annotation 3727569 3727569 . + . Note "Point mutation on a single PCR clone. T changed to a C" CHROMOSOME_III assembly_tag annotation 3727592 3727592 . + . Note "Point mutation on a singgle PCR clone. A changed to a G" CHROMOSOME_III assembly_tag annotation 3727593 3727593 . + . Note "Point mutation on a sinlge PCR clone. G changed to an A" CHROMOSOME_III assembly_tag annotation 3731128 3731131 . + . Note "End of C46F11 @ position 22947." CHROMOSOME_III assembly_tag annotation 3745415 3745419 . + . Note "End of T27D1 edit @ postion 37231 + 100 base overlap = 37331 Beginning of C14B1" CHROMOSOME_III assembly_tag annotation 3745416 3745419 . + . Note "beginning of C14B1" CHROMOSOME_III assembly_tag annotation 3745416 3745419 . + . Note "Beginning of C14B1." CHROMOSOME_III assembly_tag annotation 3753587 3753590 . + . Note "?end of left hand overlap??" CHROMOSOME_III assembly_tag annotation 3753588 3753591 . + . Note "?end of left hand overlap??" CHROMOSOME_III assembly_tag annotation 3774655 3774658 . + . Note "beginning of F34D10" CHROMOSOME_III assembly_tag annotation 3774657 3774660 . + . Note "beginning of F34D10" CHROMOSOME_III assembly_tag annotation 3774657 3774660 . + . Note "beginning of F34D10" CHROMOSOME_III assembly_tag comment 3776562 3776583 . + . Note "?messy" CHROMOSOME_III assembly_tag comment 3779103 3779108 . + . Note "?really e2" CHROMOSOME_III assembly_tag comment 3779596 3779603 . + . Note "?wrong name (e2)" CHROMOSOME_III assembly_tag annotation 3806772 3806776 . + . Note "Left Hand end of C44F1 " CHROMOSOME_III assembly_tag annotation 3810250 3810250 . + . Note "abi machine fault possibly more than likely. See if any other y50d7 reads have the same I'd edit this. If other reads show the same edit and leave. If just this read edit and annotate as mutation" CHROMOSOME_III assembly_tag annotation 3814425 3814428 . + . Note "putative end of F34D10" CHROMOSOME_III assembly_tag annotation 3820982 3820982 . + . Note "point mutation of a G to a T in traces 1856 and 1857" CHROMOSOME_III assembly_tag annotation 3823137 3823137 . + . Note "point mutation of a singlr base A to G" CHROMOSOME_III assembly_tag cosmid 3825872 3825875 . + . Note "vector: Left hand end of T24A11" CHROMOSOME_III assembly_tag annotation 3825872 3825875 . + . Note "Start of T24A11" CHROMOSOME_III assembly_tag annotation 3832899 3832899 . + . Note "singe read has extra CT" CHROMOSOME_III assembly_tag annotation 3845559 3845580 . + . Note "Single stranded with terminator" CHROMOSOME_III assembly_tag annotation 3847572 3847628 . + . Note "single stranded with terminator" CHROMOSOME_III assembly_tag annotation 3852244 3852244 . + . Note "point mutation in PCR" CHROMOSOME_III assembly_tag annotation 3852388 3852388 . + . Note "point mutation" CHROMOSOME_III assembly_tag annotation 3852417 3852417 . + . Note "Edited according to consensus although some traces may have a point mutation" CHROMOSOME_III assembly_tag annotation 3852520 3852520 . + . Note "point mutation of C to T on traces 1724, 1718, 1721, 1726" CHROMOSOME_III assembly_tag annotation 3854551 3854551 . + . Note "point mutatuion of A to G" CHROMOSOME_III assembly_tag annotation 3855060 3855079 . + . Note "single stranded with terminator across region" CHROMOSOME_III assembly_tag cosmid 3856426 3856431 . + . Note "vector: start of R13G10" CHROMOSOME_III assembly_tag Clone 3874633 3874636 . + . Note "left end: Beginning of C36A4" CHROMOSOME_III assembly_tag Clone 3895471 3895476 . + . Note "right end: End of R13G10" CHROMOSOME_III assembly_tag Clone 3914678 3914681 . + . Note "left end: Beginning of F13B10" CHROMOSOME_III assembly_tag Clone 3914678 3914681 . + . Note "left end: Beginning of F13B10" CHROMOSOME_III assembly_tag Clone 3919270 3919273 . + . Note "right end: End of C36A4" CHROMOSOME_III assembly_tag annotation 3923517 3923547 . + . Note "There proved to be an indeterminable number of Gs in this region. The current estimate is that the number of Gs is about 31 but sequence beyond the run of Gs is poorly determined on the + strand. " CHROMOSOME_III assembly_tag annotation 3923548 3923636 . + . Note "Missing + d.s. following a large run of Gs : (approx. 90 bp missing) but available - strand is terminated." CHROMOSOME_III assembly_tag annotation 3923779 3923803 . + . Note "Missing approx. 24 bp + d.s. but sequence confirmed by terminator on - strand." CHROMOSOME_III assembly_tag Clone 3936531 3936534 . + . Note "left end: Beginning of ZK1058" CHROMOSOME_III assembly_tag annotation 3941005 3941321 . + . Note "This is the beginning of an extensive region (approx 3kb) of multiple tandem repeats. There are regions which have not been sequenced on both strands. Five repeat elements have been identified which are already known (Naclerio et.al. (1992) J. Mol. Biol. 226, pp159-168 : From restriction digest and PCR information we are missing copies of element 3 and element 5 (in total, approx 800 bp are missing). The approx. copy number and size of each element is given in the tag annotation. Element 1 :7 copies of Rc123 (a 123mer)." CHROMOSOME_III assembly_tag Clone 3941096 3941100 . + . Note "right end: " CHROMOSOME_III assembly_tag Clone 3941218 3941224 . + . Note "right end: " CHROMOSOME_III assembly_tag annotation 3941322 3941471 . + . Note "Element 1 : 7 copies of Rc123 (a 123mer) " CHROMOSOME_III assembly_tag Clone 3941331 3941335 . + . Note "right end: " CHROMOSOME_III assembly_tag Clone 3941454 3941458 . + . Note "right end: " CHROMOSOME_III assembly_tag annotation 3941472 3941692 . + . Note "7 copies of Rc123 (a 123mer)_" CHROMOSOME_III assembly_tag Clone 3941566 3941570 . + . Note "right end: " CHROMOSOME_III assembly_tag Clone 3941689 3941694 . + . Note "right end: " CHROMOSOME_III assembly_tag annotation 3941693 3941845 . + . Note "7 copies of Rc123 (a 123mer) " CHROMOSOME_III assembly_tag Clone 3941802 3941804 . + . Note "right end: " CHROMOSOME_III assembly_tag annotation 3941965 3942284 . + . Note "Element 2 : 8 copies of RcC9 (40mer)" CHROMOSOME_III assembly_tag annotation 3942326 3942457 . + . Note "Element 3 : a minimum of 33 copies of RcD1 (a 15mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3942458 3942556 . + . Note "Element 3 : a minimum of 33 copies of RcD1 (a 15mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3942557 3942682 . + . Note "Element 3 : a minimum of 33 copies of RcD1 (a 15mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3942683 3942823 . + . Note "Element 3 : a minimum of 33 copies of RcD1 (a 15mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3942828 3943022 . + . Note "Element 4 : 8 copies of Rc35 (a 35mer)." CHROMOSOME_III assembly_tag annotation 3943023 3943106 . + . Note "Element 4 : 8 copies of Rc35 (a 35mer)." CHROMOSOME_III assembly_tag annotation 3943139 3943303 . + . Note "Element 5 : a minimum of 15 copies of RcC9 (a 40mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3943304 3943394 . + . Note "Element 5 : a minimum of 15 copies of RcC9 (a 40mer) from 28450 to 29060 bp. An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3943395 3943570 . + . Note "Element 5 : a minimum of 15 copies of RcC9 (a 40mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag annotation 3943571 3943755 . + . Note "Element 5 : a minimum of 15 copies of RcC9 (a 40mer). An unknown number of copies is missing here (see annotation at beginning of this repetitive region)." CHROMOSOME_III assembly_tag Clone 3951486 3951489 . + . Note "right end: end of F13B10" CHROMOSOME_III assembly_tag Clone 3951486 3951489 . + . Note "right end: End of F13B10" CHROMOSOME_III assembly_tag Clone 3965529 3965532 . + . Note "left end: Start of F37A8" CHROMOSOME_III assembly_tag annotation 3972549 3972572 . + . Note "OVERLAP WITH ZK1058" CHROMOSOME_III assembly_tag cosmid 3972560 3972564 . + . Note "vector: " CHROMOSOME_III assembly_tag ignore 3972560 3972564 . + . Note "cutoff (cloning vector): Lorist6 " CHROMOSOME_III assembly_tag Clone 3972565 3972568 . + . Note "right end: " CHROMOSOME_III assembly_tag ignore 3981394 3981398 . + . Note "cutoff (cloning vector): Lorist6 " CHROMOSOME_III assembly_tag annotation 3987334 3987351 . + . Note "Beginning of overlap with R10E9 " CHROMOSOME_III assembly_tag annotation 4006842 4006864 . + . Note "END OF F37A8" CHROMOSOME_III assembly_tag cosmid 4006992 4006995 . + . Note "vector: " CHROMOSOME_III assembly_tag ignore 4006992 4006995 . + . Note "cutoff (cloning vector): " CHROMOSOME_III assembly_tag Finished 4027870 4027875 . + . Note "Left: Y1A5A" CHROMOSOME_III assembly_tag annotation 4027970 4027975 . + . Note "END OF R10E9" CHROMOSOME_III assembly_tag Clone 4027970 4027975 . + . Note "right end: R10E9" CHROMOSOME_III assembly_tag cosmid 4028084 4028095 . + . Note "vector: " CHROMOSOME_III assembly_tag Finished 4033929 4033932 . + . Note "Left: C36E8" CHROMOSOME_III assembly_tag Clone 4033929 4033932 . + . Note "left end: C36E8" CHROMOSOME_III assembly_tag Clone 4033929 4033932 . + . Note "left end: C36E8" CHROMOSOME_III assembly_tag Finished 4034029 4034032 . + . Note "Right: Y1A5A" CHROMOSOME_III assembly_tag annotation 4064291 4064360 . + . Note "single-stranded only (60bp).\nregion has been terminated on the\n-ve strand." CHROMOSOME_III assembly_tag Clone 4065633 4065636 . + . Note "left end: T02C12" CHROMOSOME_III assembly_tag Finished 4065733 4065736 . + . Note "Right: C36E8" CHROMOSOME_III assembly_tag annotation 4072693 4072698 . + . Note "C36E8 ENDS" CHROMOSOME_III assembly_tag annotation 4088293 4088297 . + . Note "beginning of E03A3" CHROMOSOME_III assembly_tag annotation 4088293 4088304 . + . Note "E03A3 BEGINS" CHROMOSOME_III assembly_tag annotation 4098109 4098111 . + . Note "only base that differs ! (in one clone only CTCC : in all others -10- reads CCCC)" CHROMOSOME_III assembly_tag annotation 4101726 4101736 . + . Note "End of T02C12" CHROMOSOME_III assembly_tag ignore 4127490 4127490 . + . Note "cutoff (cloning vector): " CHROMOSOME_III assembly_tag annotation 4127490 4127499 . + . Note "beginning of C03C10" CHROMOSOME_III assembly_tag annotation 4127491 4127508 . + . Note "beginning of C03C10" CHROMOSOME_III assembly_tag annotation 4131275 4131295 . + . Note "end of overlap with E03A3" CHROMOSOME_III assembly_tag annotation 4148688 4148712 . + . Note "start of overlap with C30D11" CHROMOSOME_III assembly_tag cosmid 4171224 4171238 . + . Note "vector: From here onwards is C30D11 Before here is C03C10" CHROMOSOME_III assembly_tag annotation 4188693 4188696 . + . Note "Beginning of C16C10" CHROMOSOME_III assembly_tag cosmid 4188693 4188706 . + . Note "vector: C16C10 starts here" CHROMOSOME_III assembly_tag annotation 4191714 4191716 . + . Note "2 -ve clones were tried and didn't work but there is a +ve terminator across so edited" CHROMOSOME_III assembly_tag annotation 4192944 4192947 . + . Note "End of C30D11" CHROMOSOME_III assembly_tag annotation 4200987 4200989 . + . Note "Edited to GTT - Andrew's advice" CHROMOSOME_III assembly_tag annotation 4212674 4212685 . + . Note "+ reads say 12 A's - reads say 11 A's" CHROMOSOME_III assembly_tag annotation 4229173 4229173 . + . Note "Definitely a G Other reads clearly state A" CHROMOSOME_III assembly_tag annotation 4229898 4229903 . + . Note "Beginning of R74" CHROMOSOME_III assembly_tag annotation 4229898 4229914 . + . Note "beginning of R74" CHROMOSOME_III assembly_tag annotation 4229989 4230005 . + . Note "end of C16C10" CHROMOSOME_III assembly_tag annotation 4230002 4230005 . + . Note "End of C16C10" CHROMOSOME_III assembly_tag annotation 4254643 4254646 . + . Note "beginning of F43C1" CHROMOSOME_III assembly_tag annotation 4254645 4254653 . + . Note "beginning of F43C1" CHROMOSOME_III assembly_tag annotation 4255273 4255334 . + . Note "685bp to 746bp = region of poor data on one strand only (-) part of an area of tandem repeats 5 copies of 22bp element GATCCCACTCAAACACCAAGTA" CHROMOSOME_III assembly_tag annotation 4270151 4270156 . + . Note "end of R74" CHROMOSOME_III assembly_tag Finished 4289727 4289730 . + . Note "Left: Y44F5A" CHROMOSOME_III assembly_tag annotation 4289827 4289830 . + . Note "end of F43C1" CHROMOSOME_III assembly_tag Clone 4289827 4289830 . + . Note "right end: F43C1" CHROMOSOME_III assembly_tag Clone 4295769 4295772 . + . Note "left end: T08A11" CHROMOSOME_III assembly_tag Finished 4295769 4295772 . + . Note "Left: " CHROMOSOME_III assembly_tag Clone 4295769 4295772 . + . Note "left end: T08A11 left" CHROMOSOME_III assembly_tag Finished 4295869 4295872 . - . Note "Right: Y44F5A" CHROMOSOME_III assembly_tag annotation 4296196 4296206 . + . Note "insecure" CHROMOSOME_III assembly_tag annotation 4300182 4300194 . + . Note "left end of stem" CHROMOSOME_III assembly_tag annotation 4301518 4301589 . + . Note "ss, but matches inv repeat " CHROMOSOME_III assembly_tag annotation 4303211 4303223 . + . Note "right end of stem " CHROMOSOME_III assembly_tag Karen's 9331844 9331844 . + . Note "Comments: chedked, changed G to A after re-sequencing" CHROMOSOME_III assembly_tag oligo 9331939 9331955 . + . Note "serial#=m01a8check4 template=c75g9.s1 sequence=ACCATCATGTTAGCAGC flags= " CHROMOSOME_III assembly_tag compression 9332221 9332227 . + . CHROMOSOME_III assembly_tag oligo 9333160 9333176 . + . Note "serial#=M01A8.4 template=c57c3.s1 sequence=ATCCACGGGTTTTGCTC flags= C at 113 looks O/K on pos strands" CHROMOSOME_III assembly_tag oligo 9333168 9333190 . + . Note "serial#=m01a8check5 template=c47h5.s1 sequence=GTTTTGCTCAAAAACTATTAAGG flags= " CHROMOSOME_III assembly_tag oligo 9333250 9333272 . + . Note "serial#=M01A8.32 template=c47h5.s1 sequence=CGAAAAAATAGTGTTTTTTGTGG flags= " CHROMOSOME_III assembly_tag oligo 9333440 9333460 . + . Note "serial#=m01a8check6r template=c69a11.s1 sequence=GTAATTGAAGAGAATTTCACG flags= " CHROMOSOME_III assembly_tag cosmid 9333470 9333486 . + . Note "vector: cosmid vec to the right end of overlap with K01B6" CHROMOSOME_III assembly_tag comment 9333480 9333481 . - . Note "?" CHROMOSOME_III assembly_tag oligo 9333525 9333546 . + . Note "serial#=M01A8.3 templates=c90b1.s1 sequence=CTGCAATAACAGAAAATTGAAC flags= " CHROMOSOME_III assembly_tag comment 10045356 10045358 . + . Note "pJB8 " CHROMOSOME_III assembly_tag comment 10053729 10053746 . + . Note "?end of R10E12 overlap" CHROMOSOME_III assembly_tag comment 10053740 10053744 . + . Note "pJB8 " CHROMOSOME_III assembly_tag comment 10055113 10055121 . + . Note "Discrepancy on both -ve strands terminate" CHROMOSOME_III assembly_tag comment 10055386 10055405 . + . Note "from GATTTTGGCCCGTTT to GATTTTGCCCGTTT" CHROMOSOME_III assembly_tag comment 10058393 10058395 . + . Note "Missing base on only +ve strand " CHROMOSOME_III assembly_tag comment 10059778 10059781 . + . Note "Discrepancy between strands " CHROMOSOME_III assembly_tag comment 10059795 10059797 . + . Note "Discreopancy again " CHROMOSOME_III assembly_tag comment 10060356 10060361 . + . Note "?oops! Re do with ice walk or something" CHROMOSOME_III assembly_tag comment 10060385 10060387 . + . Note "Discrepancy between only 2 strands available Same for next 3 tags!! " CHROMOSOME_III assembly_tag comment 10060385 10060387 . + . Note "Discreapncy between only 2 strands available " CHROMOSOME_III assembly_tag comment 10060394 10060396 . + . Note "Disrepancy" CHROMOSOME_III assembly_tag comment 10060394 10060396 . + . Note "Same again" CHROMOSOME_III assembly_tag comment 10060424 10060441 . + . Note "Eh?! " CHROMOSOME_III assembly_tag comment 10061716 10061725 . + . Note "needs double stranding read gappy and no other reads" CHROMOSOME_III assembly_tag comment 10064198 10064216 . + . Note "?start of M04D8 overlap" CHROMOSOME_III assembly_tag comment 10068099 10068101 . + . Note "All +ve strands say 1G. All -ve strands say 2G's" CHROMOSOME_III assembly_tag comment 10075568 10075605 . + . Note "Up to here is my part of the M04D8 overlap!!" CHROMOSOME_III assembly_tag annotation 10096918 10096921 . + . Note "beginning of T16G12" CHROMOSOME_III assembly_tag annotation 10102693 10102696 . + . Note "end of overlap with M04D8" CHROMOSOME_III assembly_tag annotation 10134831 10134834 . + . Note "beginning of T16H12" CHROMOSOME_III assembly_tag annotation 10169237 10169243 . + . Note "Start analysis here to overlap with T16H12 submitted data by 100 bases" CHROMOSOME_III assembly_tag annotation 10169553 10169557 . + . Note "End of T16H12" CHROMOSOME_III assembly_tag annotation 10181735 10181864 . + . Note "very poor data across this region covered only by sequence from PCR products (from cosmid)" CHROMOSOME_III assembly_tag annotation 10185406 10185449 . + . Note "These 43bp appear to be deleted in a sub-species of the cosmid used in sequencing. Genomic PCR confirms that these bases are present in genomic DNA." CHROMOSOME_III assembly_tag annotation 10188989 10189009 . + . Note "Number of C's estimated to be 21 from one terminator read only. No other good reads to confirm this" CHROMOSOME_III assembly_tag annotation 10191418 10191445 . + . Note "No good data on + strand for approx 30bp but good data on other strand. Adjacent to a (TC)n repeat : about 40 copies (i.e. 80bp long)" CHROMOSOME_III assembly_tag annotation 10196967 10196970 . + . Note "Left end of K08E5 " CHROMOSOME_III assembly_tag annotation 10196967 10196977 . + . CHROMOSOME_III assembly_tag annotation 10208429 10208432 . + . Note "?End of ZK1128" CHROMOSOME_III assembly_tag Finished 10229695 10229698 . + . Note "Left: T20G5" CHROMOSOME_III assembly_tag annotation 10229695 10229698 . + . Note "? left End of T20G5" CHROMOSOME_III assembly_tag Clone 10229695 10229698 . + . Note "left end: T20G5" CHROMOSOME_III assembly_tag Finished 10277690 10277693 . + . Note "Left: Y70G10A" CHROMOSOME_III assembly_tag TeamLeader 10277751 10277751 . + . Note "comment: crl 1998-08-12sjj picked up this difference betweenT20G5 and Y70G10A. I believe Y70G10A to be correct and have edited this to one G. The +ve primers have no sign of an expansion, and G peak is clearly 1 base. The -ve primer is not of verygood quality. There are lots of good quality terminators in Y70G10A to confirm 1 G. Does not appear to be a variation, just an error." CHROMOSOME_III assembly_tag Clone 10277786 10277789 . + . Note "right end: T20G5" CHROMOSOME_III assembly_tag Finished 10277786 10277789 . + . Note "Right: T20G5" CHROMOSOME_III assembly_tag Clone 10277786 10277789 . - . Note "right end: T20G5" CHROMOSOME_III assembly_tag annotation 10282917 10284347 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[x] Forced join[ ] OtherAdd a comment here -Region of 45 bp tandem repeat, typicalsequence: CAAAATGTTTTAAACTGAGAATTATGGAAAAAAATGGTAAATTTAAATGTGCACTGGTTTTSome base pair differences have been edited. Restriction digest data (PSTI,XHOI) suggest 3kb is missing from the assembly of a region which includes boththis repeat region and a region comprised of a 161 bp tandem repeat." CHROMOSOME_III assembly_tag annotation 10284491 10286169 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[x] Forced join[ ] OtherAdd a comment here -Region of 161 bp tandem repeat, typicalsequence: CATTCTTTTTTATTGCATAAAACTGTTCAGCATAGTCAAAAATACCAGAATATGCCAATCAAAGTATAATAGCTTGTACGGAAGTTTTTTTTTAAAAATTGATAAAAAATATATAAAAGCTGATTTTTTCAAAAATTCAAAAGTATGGGAAAATCATATGGAGTSome base pair differences have been edited. Restriction digest data (PSTI,XHOI) suggest 3kb is missing from the assembly of a region which includes boththis repeat region and a region comprised of a 45 bp tandem repeat." CHROMOSOME_III assembly_tag annotation 10300935 10301047 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region consisting solely of short insert reads derived from a single pUC clone.Assembly has been confirmed by restriction digest (PSTI, XHOI)." CHROMOSOME_III assembly_tag Finished 10303843 10303846 . + . Note "Left: R01H10" CHROMOSOME_III assembly_tag Clone 10303843 10303848 . + . Note "left end: R01H10" CHROMOSOME_III assembly_tag Clone 10303843 10303848 . - . Note "left end: R01H10" CHROMOSOME_III assembly_tag Finished 10303939 10303942 . + . Note "Right: Y70G10A" CHROMOSOME_III assembly_tag Finished 10335094 10335097 . + . Note "Right: R01H10" CHROMOSOME_III assembly_tag Clone 10354260 10354263 . + . Note "left end: T07A5" CHROMOSOME_III assembly_tag annotation 10356125 10356125 . + . Note "?check this by re sequencing o05c7.s1 point mutation C > G on single read" CHROMOSOME_III assembly_tag Clone 10360756 10360760 . + . Note "right end: K10G9 right end " CHROMOSOME_III assembly_tag Clone 10360762 10360765 . + . Note "right end: K10G9" CHROMOSOME_III assembly_tag annotation 10367631 10367631 . + . Note "point mutation C > T on single read" CHROMOSOME_III assembly_tag annotation 10378602 10378680 . + . Note "?This region has proved almost impossible to sequence through. For this reason the sequence at this point in particular and across this whole inverted repeat region are not to be regarded as 100% accurate" CHROMOSOME_III assembly_tag annotation 10378610 10378614 . + . Note "This region has proved almost impossible to sequence through. For this reason the sequence at this point in particular and across this whole inverted repeat region are not to be regarded as 100% accurate" CHROMOSOME_III assembly_tag Finished 10382431 10382434 . + . Note "Left: T07C4" CHROMOSOME_III assembly_tag Clone 10382431 10382434 . + . Note "left end: T07C4 START" CHROMOSOME_III assembly_tag Clone 10382431 10382434 . + . Note "left end: Start of overlap with T07C4" CHROMOSOME_III assembly_tag Clone 10391271 10391274 . + . Note "right end: END of T07A5" CHROMOSOME_III assembly_tag annotation 10415804 10415806 . + . Note "Start of C38H2 " CHROMOSOME_III assembly_tag Clone 10415804 10415807 . + . Note "left end: START of C38H2" CHROMOSOME_III assembly_tag Finished 10415904 10415907 . + . Note "Right: T07C4" CHROMOSOME_III assembly_tag annotation 10427177 10427178 . + . Note "Submit as CC (majority of reads in pjb8). Note when in cosmid vector Lorist 4 it is CG. " CHROMOSOME_III assembly_tag annotation 10447653 10447658 . + . Note "left hand end" CHROMOSOME_III assembly_tag annotation 10453329 10453335 . + . Note "end of C38H2" CHROMOSOME_III assembly_tag annotation 10456972 10457002 . + . Note "weak data in repeat region but probably correct" CHROMOSOME_III assembly_tag Finished 10488329 10488332 . + . Note "Left: H04D03" CHROMOSOME_III assembly_tag annotation 10488426 10488432 . + . Note "right hand end" CHROMOSOME_III assembly_tag Clone 10488429 10488432 . + . Note "right end: M03C11" CHROMOSOME_III assembly_tag Clone 10509308 10509311 . - . Note "left end: D2045" CHROMOSOME_III assembly_tag Clone 10509308 10509311 . - . Note "left end: D2045" CHROMOSOME_III assembly_tag Finished 10509308 10509311 . - . Note "Left: D2045" CHROMOSOME_III assembly_tag Finished 10509408 10509411 . + . Note "Right: H04D03" CHROMOSOME_III assembly_tag Clone 10546453 10546456 . - . Note "left end: F43D9" CHROMOSOME_III assembly_tag Finished 10546553 10546556 . + . Note "Right: D2045" CHROMOSOME_III assembly_tag annotation 10578964 10578967 . + . Note "LH end T21C12" CHROMOSOME_III assembly_tag Clone 10578964 10578967 . + . Note "left end: Beginning of T21C12" CHROMOSOME_III assembly_tag annotation 10579474 10579486 . + . CHROMOSOME_III assembly_tag Clone 10584251 10584254 . + . Note "right end: End of F43D9" CHROMOSOME_III assembly_tag annotation 10584251 10584255 . + . Note "Rh end of F43D9 Lorist 6" CHROMOSOME_III assembly_tag annotation 10589626 10589636 . + . CHROMOSOME_III assembly_tag annotation 10591278 10591298 . + . CHROMOSOME_III assembly_tag annotation 10602505 10602655 . + . Note "No + d.s. across bases 23541 to 23692 (approx 150 bp). Sequence confirmed by terminators on opposite strand." CHROMOSOME_III assembly_tag annotation 10607511 10607608 . + . Note "No + d.s. across bases 28546 to 28645 (100bp). Sequence confirmed by terminators on opposite strand." CHROMOSOME_III assembly_tag Finished 10617618 10617623 . + . Note "Left: Y45F3A" CHROMOSOME_III assembly_tag Clone 10617718 10617723 . + . Note "right end: T21C12" CHROMOSOME_III assembly_tag annotation 10617745 10617750 . + . Note "RH end of T21C12 Lorist 2" CHROMOSOME_III assembly_tag Clone 10617747 10617750 . + . Note "right end: End of T21C12" CHROMOSOME_III assembly_tag oligo 10622201 10622217 . + . Note "serial#=Y45F3.9 \nsequence=GTAAATCGACATCAGCG\nflags=\n" CHROMOSOME_III assembly_tag oligo 10624533 10624551 . - . Note "serial#=Y45F3.5 \ntemplate=sr58a3\nsequence=GGAGTAATCTGTATAATGG\nflags=\n" CHROMOSOME_III assembly_tag annotation 10625349 10625738 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSonicated pUC clones from sr66e5" CHROMOSOME_III assembly_tag annotation 10625822 10626142 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSonicated pUC clones from sr66e5" CHROMOSOME_III assembly_tag annotation 10626305 10626388 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSonicated pUC clones from sr59f1" CHROMOSOME_III assembly_tag oligo 10626665 10626682 . - . Note "serial#=Y45F3.6 \ntemplate=\nsequence=ATCTCTTAGCGAAAACTG\nflags=\n" CHROMOSOME_III assembly_tag annotation 10626687 10626777 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSonicated pUC clones from sr59f1" CHROMOSOME_III assembly_tag oligo 10627063 10627079 . - . Note "serial#=Y45F3.3 \ntemplate=sr59f1.p1U \nsequence=TTCCGTAGAGGTTTAGG\nflags=\n" CHROMOSOME_III assembly_tag Clone 10654166 10654171 . + . Note "left end: Y39A1" CHROMOSOME_III assembly_tag Finished 10654166 10654171 . + . Note "Left: Y39A1A" CHROMOSOME_III assembly_tag Clone 10654166 10654171 . - . Note "left end: Y39A1\n\n" CHROMOSOME_III assembly_tag Finished 10654266 10654271 . + . Note "Right: Y45F3A" CHROMOSOME_III assembly_tag annotation 10662142 10662145 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\n" CHROMOSOME_III assembly_tag annotation 10712757 10712784 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\n" CHROMOSOME_III assembly_tag Clone 10765020 10765025 . + . Note "left end: W09D10" CHROMOSOME_III assembly_tag Clone 10765019 10765026 . - . Note "left end: W09D10" CHROMOSOME_III assembly_tag Finished 10765019 10765026 . - . Note "Left: W09D10" CHROMOSOME_III assembly_tag Finished 10765120 10765125 . + . Note "Right: Y39A1A" CHROMOSOME_III assembly_tag Clone 10780324 10780327 . - . Note "left end: K01G5" CHROMOSOME_III assembly_tag annotation 10790944 10790959 . - . Note "number of Cs may not be accurate.\nsome M13 subclones have deleted." CHROMOSOME_III assembly_tag Finished 10798836 10798839 . + . Note "Left: K01G5" CHROMOSOME_III assembly_tag Clone 10798936 10798939 . + . Note "right end: W09D10" CHROMOSOME_III assembly_tag Finished 10798936 10798939 . + . Note "Right: W09D10" CHROMOSOME_III assembly_tag Clone 10798936 10798939 . - . Note "left end: W09D10" CHROMOSOME_III assembly_tag Finished 10818174 10818177 . + . Note "Left: Y39A1B" CHROMOSOME_III assembly_tag Clone 10818274 10818277 . + . Note "right end: K01G5" CHROMOSOME_III assembly_tag Finished 10818274 10818277 . - . Note "Right: K01G5" CHROMOSOME_III assembly_tag Clone 10818274 10818277 . - . Note "right end: K01G5" CHROMOSOME_III assembly_tag Clone 10856593 10856596 . + . Note "left end: K11D9" CHROMOSOME_III assembly_tag Clone 10856593 10856596 . - . Note "left end: K11D9" CHROMOSOME_III assembly_tag Finished 10856593 10856596 . - . Note "Left: K11D9" CHROMOSOME_III assembly_tag Finished 10856693 10856696 . + . Note "Right: Y39A1B" CHROMOSOME_III assembly_tag annotation 10865325 10865342 . + . Note "no. of Gs may not be accurate." CHROMOSOME_III assembly_tag Clone 10865711 10865716 . - . Note "right end: R17" CHROMOSOME_III assembly_tag annotation 10887947 10887979 . - . Note "Single pUC clone covering this region." CHROMOSOME_III assembly_tag Finished 10888694 10888697 . - . Note "Left: R17" CHROMOSOME_III assembly_tag Finished 10888794 10888797 . - . Note "Right: K11D9" CHROMOSOME_III assembly_tag Clone 10888794 10888797 . - . Note "right end: K11D9" CHROMOSOME_III assembly_tag Clone 10888794 10888797 . - . Note "right end: K11D9 left end" CHROMOSOME_III assembly_tag Finished 10908607 10908612 . + . Note "Left: Y39A1C" CHROMOSOME_III assembly_tag Clone 10908707 10908712 . + . Note "right end: R17" CHROMOSOME_III assembly_tag Finished 10908707 10908712 . - . Note "Right: R17" CHROMOSOME_III assembly_tag Clone 10908707 10908712 . - . Note "right end: R17" CHROMOSOME_III assembly_tag Clone 10926649 10926652 . + . Note "left end: C44B9" CHROMOSOME_III assembly_tag Clone 10926649 10926652 . + . Note "left end: C44B9" CHROMOSOME_III assembly_tag Finished 10926649 10926652 . + . Note "Left: C44B9" CHROMOSOME_III assembly_tag Finished 10926749 10926752 . + . Note "Right: Y39A1C" CHROMOSOME_III assembly_tag Finished 10961245 10961248 . + . Note "Left: M142" CHROMOSOME_III assembly_tag Clone 10961245 10961248 . + . Note "left end: M142" CHROMOSOME_III assembly_tag Clone 10961245 10961248 . + . Note "left end: M142" CHROMOSOME_III assembly_tag Finished 10961345 10961348 . + . Note "Right: C44B9" CHROMOSOME_III assembly_tag Clone 10966300 10966303 . + . Note "right end: C44B9" CHROMOSOME_III assembly_tag annotation 10985465 10985467 . + . Note "G missing in a single M13 clone" CHROMOSOME_III assembly_tag annotation 10985465 10985467 . + . Note "G missing" CHROMOSOME_III assembly_tag Finished 10997447 10997450 . + . Note "Left: Y52D3" CHROMOSOME_III assembly_tag Clone 10997547 10997550 . + . Note "right end: M142" CHROMOSOME_III assembly_tag Finished 10997547 10997550 . + . Note "Right: M142" CHROMOSOME_III assembly_tag Clone 10997547 10997550 . + . Note "right end: End of M142" CHROMOSOME_III assembly_tag Clone 10997550 10997550 . + . Note "left end: " CHROMOSOME_III assembly_tag Clone 11005801 11005806 . + . Note "left end: " CHROMOSOME_III assembly_tag Clone 11005801 11005806 . + . Note "left end: Y48A6A" CHROMOSOME_III assembly_tag Finished 11005801 11005806 . + . Note "Left: Y48A6A" CHROMOSOME_III assembly_tag Finished 11005901 11005906 . + . Note "Right: " CHROMOSOME_III assembly_tag Clone 11013001 11013004 . + . Note "left end: W05B2" CHROMOSOME_III assembly_tag Clone 11013001 11013004 . + . Note "right end: Y48A6A" CHROMOSOME_III assembly_tag Finished 11013001 11013004 . - . Note "Left: W05B2" CHROMOSOME_III assembly_tag Clone 11013001 11013004 . - . Note "left end: W05B2" CHROMOSOME_III assembly_tag Finished 11013097 11013100 . + . Note "Right: Y48A6A" CHROMOSOME_III assembly_tag Finished 11048430 11048433 . + . Note "Left: Y48A6B" CHROMOSOME_III assembly_tag Finished 11048525 11048530 . - . Note "Right: W05B2" CHROMOSOME_III assembly_tag Clone 11048525 11048530 . - . Note "right end: W05B2" CHROMOSOME_III assembly_tag annotation 11062958 11062969 . + . Note "tandem repeat between 57320 - 59030 so\ncovering 1.7kb . \n70 copies of CAATCTATTTTTTGGTATG\n80 copies of TTTTTTGGTATG\n76 copies of CAATCTATTTTTT\nassembled correct as possible according\nto read pairs, not yet confirmed by\ndigest." CHROMOSOME_III assembly_tag annotation 11110476 11110481 . + . Note "clone so42c6 has been sized and is as\npredicted so inverted repeat asembled\ncorrectly." CHROMOSOME_III assembly_tag Clone 11123402 11123405 . + . Note "left end: W09D6" CHROMOSOME_III assembly_tag Clone 11123402 11123405 . + . Note "left end: W09D6" CHROMOSOME_III assembly_tag Finished 11123402 11123405 . - . Note "Left: W09D6" CHROMOSOME_III assembly_tag Finished 11123499 11123502 . + . Note "Right: Y48A6B" CHROMOSOME_III assembly_tag Finished 11158801 11158804 . + . Note "Left: Y48A6C" CHROMOSOME_III assembly_tag Finished 11158901 11158904 . + . Note "Right: W09D6" CHROMOSOME_III assembly_tag Clone 11158901 11158904 . + . Note "right end: W09D6" CHROMOSOME_III assembly_tag Clone 11158901 11158904 . + . Note "right end: W09D6" CHROMOSOME_III assembly_tag Clone 11194436 11194441 . + . Note "left end: Y47D3" CHROMOSOME_III assembly_tag Clone 11194436 11194441 . + . Note "left end: Y47D3" CHROMOSOME_III assembly_tag Finished 11194436 11194441 . + . Note "Left: Y47D3A" CHROMOSOME_III assembly_tag Finished 11194536 11194539 . + . Note "Right: Y48A6C" CHROMOSOME_III assembly_tag annotation 11208597 11208604 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nPrimer read only. Loop of inverted\nrepeat." CHROMOSOME_III assembly_tag annotation 11208605 11208665 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here -\nPrimer reads only." CHROMOSOME_III assembly_tag Clone 11256154 11256157 . + . Note "left end: C41D8" CHROMOSOME_III assembly_tag Clone 11275661 11275666 . - . Note "right end: Y48A6" CHROMOSOME_III assembly_tag annotation 11388561 11388578 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nPrimer read\n" CHROMOSOME_III assembly_tag Clone 11394149 11394152 . - . Note "left end: T28D6" CHROMOSOME_III assembly_tag Finished 11394149 11394152 . - . Note "Left: T28D6" CHROMOSOME_III assembly_tag Finished 11394246 11394249 . + . Note "Right: Y47D3A" CHROMOSOME_III assembly_tag Finished 11434120 11434123 . + . Note "Left: Y47D3B" CHROMOSOME_III assembly_tag Finished 11434220 11434223 . - . Note "Right: T28D6" CHROMOSOME_III assembly_tag Clone 11434220 11434223 . - . Note "right end: T28D6 " CHROMOSOME_III assembly_tag annotation 11487366 11494203 . + . Note "[x] Tandem repeat \n[ ] Single clone region \n[ ] Forced join \n[ ] Other \nComment\n159 copies of a 43bp repeat.\nContains 3 forced joins and some single\nclone regions." CHROMOSOME_III assembly_tag Clone 11495975 11495978 . + . Note "left end: H10N23" CHROMOSOME_III assembly_tag Finished 11529982 11529985 . - . Note "Left: Y66A7AL" CHROMOSOME_III assembly_tag Clone 11530082 11530087 . + . Note "right end: Y47D3" CHROMOSOME_III assembly_tag Clone 11530082 11530087 . + . Note "right end: Y47D3" CHROMOSOME_III assembly_tag Finished 11530084 11530087 . + . Note "Right: Y47D3B" CHROMOSOME_III assembly_tag annotation 11533174 11533193 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Uncertain number of Cs." CHROMOSOME_III assembly_tag Finished 11545719 11545724 . + . Note "Left: Y66D12A" CHROMOSOME_III assembly_tag Finished 11545819 11545825 . + . Note "Right: Y66A7AL" CHROMOSOME_III assembly_tag Clone 11545819 11545825 . + . Note "right end: Y66A7AL" CHROMOSOME_III assembly_tag Clone 11545819 11545826 . + . Note "right end: Y66A7AL" CHROMOSOME_III assembly_tag Finished 11545820 11545825 . + . Note "Left: Y66A7AR" CHROMOSOME_III assembly_tag Clone 11545820 11545825 . - . Note "left end: Y66A7AR" CHROMOSOME_III assembly_tag annotation 11555472 11555486 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - this inverted repeat may not be truncated - evidence is conflicting" CHROMOSOME_III assembly_tag annotation 11556821 11556828 . - . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in inverted repeat" CHROMOSOME_III assembly_tag annotation 11587677 11587869 . - . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - subclone instability in tandem repeat" CHROMOSOME_III assembly_tag annotation 11611619 11611740 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in tandem repeat" CHROMOSOME_III assembly_tag annotation 11621319 11621388 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in tandem repeat" CHROMOSOME_III assembly_tag annotation 11629012 11629045 . - . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [x] Forced join [ ] Other Add a comment here - possibly tandem IR2s" CHROMOSOME_III assembly_tag annotation 11643940 11643945 . - . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in IR2" CHROMOSOME_III assembly_tag annotation 11653667 11653865 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - in tandem repeat" CHROMOSOME_III assembly_tag Clone 11659494 11659497 . + . Note "left end: C37G2" CHROMOSOME_III assembly_tag Clone 11668762 11668767 . + . Note "right end: Y66A7AL" CHROMOSOME_III assembly_tag Finished 11668762 11668767 . + . Note "Right: Y66A7AL" CHROMOSOME_III assembly_tag Finished 11668762 11668769 . + . Note "Left: Y66A7AR" CHROMOSOME_III assembly_tag Clone 11668762 11668769 . + . Note "left end: Y66A7AR" CHROMOSOME_III assembly_tag Clone 11668762 11668769 . - . Note "left end: Y66A7AR" CHROMOSOME_III assembly_tag Finished 11668862 11668867 . - . Note "Right: Y66D12A" CHROMOSOME_III assembly_tag Clone 11679421 11679426 . - . Note "right end: Y66D12A" CHROMOSOME_III assembly_tag Clone 11696232 11696237 . + . Note "left end: Y41C4" CHROMOSOME_III assembly_tag Finished 11696319 11696322 . - . Note "Right: Y66A7AR" CHROMOSOME_III assembly_tag Clone 11825188 11825191 . + . Note "left end: C24H11" CHROMOSOME_III assembly_tag Finished 11825188 11825191 . + . Note "Left: C24H11" CHROMOSOME_III assembly_tag annotation 11825188 11825191 . + . Note "[ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other CommentRestriction digest data (AVAI, AVAII, BAMHI, ECORI, KPNI) suggest the assembly is too large, but no way has been foundof assembling the cosmid so that it matches the digest." CHROMOSOME_III assembly_tag annotation 11832074 11832823 . + . Note "[x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other CommentRegion of 79bp tandem repeat. Restriction digest data do not agree with the assembly of the cosmid (the assembly is larger than indicated by the digest). Data from the restriction enzymes used (ALUI, AVAI, AVAII, BAMHI,ECORI, KPNI) conflict as to how much is missing from the assembly of this tandemrepeat. " CHROMOSOME_III assembly_tag annotation 11850277 11850280 . + . Note "[ ] Tandem repeat \n[ ] Single clone region \n[ ] Forced join \n[x] Other \nComment\nOne clone has TA, 15 clones have TAGA." CHROMOSOME_III assembly_tag annotation 11853091 11853091 . + . Note "[ ] Tandem repeat \n[ ] Single clone region \n[ ] Forced join \n[x] Other \nComment\nOne clone has C, 12 clones have A." CHROMOSOME_III assembly_tag Finished 11862938 11862941 . + . Note "Left: C18D11" CHROMOSOME_III assembly_tag Finished 11863038 11863041 . + . Note "Right: C24H11" CHROMOSOME_III assembly_tag Clone 11863038 11863041 . + . Note "right end: C24H11" CHROMOSOME_III assembly_tag Clone 11863038 11863041 . + . Note "right end: C24H11" CHROMOSOME_III assembly_tag annotation 11891335 11891351 . + . Note "this region is covered by a single clone which is a read generated from a sonication of clone sx66a5. This region is consistent with the digest" CHROMOSOME_III assembly_tag annotation 11891544 11891556 . - . Note "Region contains repeat elements. The cosmid if consistent with the digest" CHROMOSOME_III assembly_tag Finished 11892083 11892086 . + . Note "Left: Y56A3A" CHROMOSOME_III assembly_tag Finished 11892183 11892186 . + . Note "Right: C18D11" CHROMOSOME_III assembly_tag Clone 11892183 11892186 . + . Note "right end: C18D11\n" CHROMOSOME_III assembly_tag Clone 11892183 11892186 . + . Note "right end: C18D11" CHROMOSOME_III assembly_tag Finisher 11898591 11898691 . + . Note "comment: single clone region possibly" CHROMOSOME_III assembly_tag Finisher 11899218 11899300 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11901556 11901664 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11908909 11909014 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11913227 11913542 . + . Note "comment: " CHROMOSOME_III assembly_tag annotation 11916114 11916150 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\n" CHROMOSOME_III assembly_tag Finisher 11918074 11918178 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11918203 11918321 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11918856 11918973 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11920122 11920128 . + . Note "comment: " CHROMOSOME_III assembly_tag annotation 11920125 11920125 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[x] OtherAdd a comment here - base pair differencebetween Y56A3 & Y41C4 . Y56A3 reads aAtwhereas Y41C4 reads aTt" CHROMOSOME_III assembly_tag Finisher 11925842 11925900 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11937413 11937457 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11941561 11941649 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11948713 11948782 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11950139 11950184 . + . Note "comment: " CHROMOSOME_III assembly_tag Clone 11954293 11954298 . + . Note "right end: Y41C4" CHROMOSOME_III assembly_tag Finisher 11954628 11954741 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11954742 11954878 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11955720 11955749 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11957102 11957251 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11958285 11958436 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11959917 11960034 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11961289 11961423 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11967085 11967168 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11968263 11968293 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11968411 11968461 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11969864 11969996 . + . Note "comment: " CHROMOSOME_III assembly_tag Polymorphism 11970821 11970827 . + . CHROMOSOME_III assembly_tag Polymorphism 11971086 11971092 . + . CHROMOSOME_III assembly_tag Finisher 11972794 11972942 . + . Note "comment: " CHROMOSOME_III assembly_tag Polymorphism 11973304 11973310 . + . CHROMOSOME_III assembly_tag Polymorphism 11974998 11975004 . + . CHROMOSOME_III assembly_tag Polymorphism 11975214 11975220 . + . CHROMOSOME_III assembly_tag Polymorphism 11975817 11975823 . + . CHROMOSOME_III assembly_tag Polymorphism 11976016 11976022 . + . CHROMOSOME_III assembly_tag Finisher 11977780 11978111 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11979484 11979484 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11979774 11979817 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11980199 11980348 . + . Note "comment: " CHROMOSOME_III assembly_tag Polymorphism 11981241 11981247 . + . CHROMOSOME_III assembly_tag Polymorphism 11981701 11981707 . + . CHROMOSOME_III assembly_tag Finisher 11981710 11982141 . + . Note "comment: " CHROMOSOME_III assembly_tag Polymorphism 11982338 11982344 . + . CHROMOSOME_III assembly_tag Finisher 11982339 11982344 . - . Note "comment: " CHROMOSOME_III assembly_tag Polymorphism 11982561 11982567 . + . CHROMOSOME_III assembly_tag Polymorphism 11982756 11982762 . + . CHROMOSOME_III assembly_tag Polymorphism 11983206 11983212 . + . CHROMOSOME_III assembly_tag Polymorphism 11983377 11983383 . + . CHROMOSOME_III assembly_tag Polymorphism 11983457 11983463 . + . CHROMOSOME_III assembly_tag Polymorphism 11985443 11985449 . + . CHROMOSOME_III assembly_tag Polymorphism 11985474 11985480 . + . CHROMOSOME_III assembly_tag Polymorphism 11985483 11985489 . + . CHROMOSOME_III assembly_tag Polymorphism 11985543 11985549 . + . CHROMOSOME_III assembly_tag Polymorphism 11985553 11985559 . + . CHROMOSOME_III assembly_tag Polymorphism 11985640 11985646 . + . CHROMOSOME_III assembly_tag Finisher 11985967 11986165 . + . Note "comment: " CHROMOSOME_III assembly_tag Polymorphism 11986041 11986047 . + . CHROMOSOME_III assembly_tag Polymorphism 11986236 11986242 . + . CHROMOSOME_III assembly_tag Polymorphism 11986389 11986395 . + . CHROMOSOME_III assembly_tag Polymorphism 11986429 11986435 . + . CHROMOSOME_III assembly_tag Polymorphism 11986449 11986455 . + . CHROMOSOME_III assembly_tag Polymorphism 11986459 11986465 . + . CHROMOSOME_III assembly_tag Polymorphism 11986507 11986513 . + . CHROMOSOME_III assembly_tag Polymorphism 11986559 11986565 . + . CHROMOSOME_III assembly_tag Polymorphism 11986569 11986575 . + . CHROMOSOME_III assembly_tag Polymorphism 11986586 11986592 . + . CHROMOSOME_III assembly_tag Polymorphism 11986616 11986622 . + . CHROMOSOME_III assembly_tag Polymorphism 11986686 11986692 . + . CHROMOSOME_III assembly_tag Polymorphism 11986756 11986762 . + . CHROMOSOME_III assembly_tag Polymorphism 11986860 11986866 . + . CHROMOSOME_III assembly_tag Finisher 11986897 11986992 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 11987903 11988403 . + . Note "comment: " CHROMOSOME_III assembly_tag Polymorphism 11989842 11989852 . + . CHROMOSOME_III assembly_tag Polymorphism 11989851 11989861 . + . CHROMOSOME_III assembly_tag Polymorphism 11989860 11989870 . + . CHROMOSOME_III assembly_tag Polymorphism 11989869 11989879 . + . CHROMOSOME_III assembly_tag Finisher 11989876 11989892 . + . Note "comment: tandem repeat" CHROMOSOME_III assembly_tag Polymorphism 11989948 11989958 . + . CHROMOSOME_III assembly_tag Finisher 11989955 11989971 . + . Note "comment: tandem repeat" CHROMOSOME_III assembly_tag Polymorphism 11990082 11990092 . + . CHROMOSOME_III assembly_tag Polymorphism 11990154 11990164 . + . CHROMOSOME_III assembly_tag Polymorphism 11990208 11990218 . + . CHROMOSOME_III assembly_tag Finisher 11990215 11990231 . + . Note "comment: tandem repeat" CHROMOSOME_III assembly_tag Polymorphism 11990280 11990290 . + . CHROMOSOME_III assembly_tag annotation 11990295 11990348 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[x] Forced join[ ] OtherAdd a comment here - False join in small tandem repeat TAGGTATTATAGGTAT. At least 18 copies in a region of about 700 bp" CHROMOSOME_III assembly_tag Polymorphism 11990325 11990335 . + . CHROMOSOME_III assembly_tag Polymorphism 11990388 11990398 . + . CHROMOSOME_III assembly_tag Polymorphism 11990407 11990420 . + . CHROMOSOME_III assembly_tag Finisher 11990431 11990447 . + . Note "comment: tandem repeat" CHROMOSOME_III assembly_tag Polymorphism 11990523 11990533 . + . CHROMOSOME_III assembly_tag Finisher 11993081 11993103 . + . Note "comment: loop??" CHROMOSOME_III assembly_tag Finisher 11993152 11993160 . - . Note "comment: very poor single clone" CHROMOSOME_III assembly_tag Polymorphism 11996983 11996996 . + . Note "loop of inverted repeat" CHROMOSOME_III assembly_tag Finisher 11999416 11999511 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12000084 12000094 . + . Note "comment: single clone" CHROMOSOME_III assembly_tag Finisher 12000944 12001013 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12002134 12002436 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12004562 12004753 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12005475 12005713 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12006272 12006693 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12007439 12007542 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12008343 12008481 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12008885 12009016 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12009037 12009071 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12010259 12011102 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12011750 12012562 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12014664 12014755 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12015887 12015946 . + . Note "comment: single clone " CHROMOSOME_III assembly_tag Finisher 12016099 12016203 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12017184 12017646 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12017633 12017637 . + . Note "comment: doing reverse first" CHROMOSOME_III assembly_tag Finisher 12017647 12017690 . + . Note "comment: " CHROMOSOME_III assembly_tag Polymorphism 12017715 12017715 . + . CHROMOSOME_III assembly_tag Polymorphism 12017953 12017971 . + . CHROMOSOME_III assembly_tag Polymorphism 12017973 12017978 . + . CHROMOSOME_III assembly_tag Polymorphism 12017981 12018015 . + . CHROMOSOME_III assembly_tag Polymorphism 12018017 12018109 . + . CHROMOSOME_III assembly_tag Finisher 12018625 12019064 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12020960 12020972 . - . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12021047 12021186 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12023094 12023099 . + . Note "comment: doing big dye term" CHROMOSOME_III assembly_tag Finisher 12023721 12024127 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12023748 12023752 . + . Note "comment: doing big dye term" CHROMOSOME_III assembly_tag Finisher 12024598 12024657 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12024734 12024740 . + . Note "comment: doing big dye term" CHROMOSOME_III assembly_tag Finisher 12025446 12025633 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12028366 12028370 . + . Note "comment: doing term" CHROMOSOME_III assembly_tag Finisher 12029514 12029592 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12030131 12030278 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12030360 12030367 . + . Note "comment: final try at term" CHROMOSOME_III assembly_tag Finisher 12030592 12030706 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12032909 12032912 . + . Note "comment: auto edit BIG mistake!!" CHROMOSOME_III assembly_tag Finisher 12033496 12033522 . + . Note "comment: loop of inverted repeat??" CHROMOSOME_III assembly_tag Finisher 12033761 12034120 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12034154 12034208 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12035607 12036417 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12036290 12036294 . + . Note "comment: doing big dye term" CHROMOSOME_III assembly_tag Finisher 12036879 12037031 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12037448 12037493 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12039797 12039801 . + . Note "comment: doing rev ET" CHROMOSOME_III assembly_tag Finisher 12040841 12041321 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12041502 12042287 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12042579 12043120 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12043968 12044112 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12046911 12047206 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12049067 12049366 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12049785 12050294 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12049783 12049832 . - . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12049833 12050084 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12050681 12051213 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12051924 12051951 . + . Note "comment: loop of inverted possibly" CHROMOSOME_III assembly_tag annotation 12052090 12052119 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nArm of inverted repeat." CHROMOSOME_III assembly_tag Finisher 12053281 12053368 . + . Note "comment: single clone" CHROMOSOME_III assembly_tag Finisher 12054191 12054204 . + . Note "comment: single clone" CHROMOSOME_III assembly_tag Finisher 12055241 12055524 . + . Note "comment: " CHROMOSOME_III assembly_tag Finisher 12057080 12057085 . + . Note "comment: no primers" CHROMOSOME_III assembly_tag Finisher 12059372 12059723 . + . Note "comment: " CHROMOSOME_III assembly_tag Finished 12061347 12061350 . + . Note "Left: Y79H2A" CHROMOSOME_III assembly_tag Clone 12061347 12061351 . + . Note "left end: Y79H2" CHROMOSOME_III assembly_tag Clone 12061347 12061351 . + . Note "left end: Y79H2" CHROMOSOME_III assembly_tag Finished 12061442 12061446 . + . Note "Right: Y56A3A" CHROMOSOME_III assembly_tag Clone 12084117 12084122 . + . Note "right end: Y56A3" CHROMOSOME_III assembly_tag annotation 12111210 12111314 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nShort insert library made from pUC clone\nsz21h3." CHROMOSOME_III assembly_tag annotation 12127155 12127298 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here -\nReads derived from 2 PCR products both\nmade using oligos 35 and 18" CHROMOSOME_III assembly_tag Clone 12127388 12127393 . + . Note "left end: Y75B8" CHROMOSOME_III assembly_tag Finished 12127388 12127393 . + . Note "Left: Y75B8A" CHROMOSOME_III assembly_tag Clone 12127388 12127393 . + . Note "left end: Y75B8" CHROMOSOME_III assembly_tag Finished 12127487 12127490 . + . Note "Right: Y79H2A" CHROMOSOME_III assembly_tag annotation 12161104 12161227 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region only covered by a single clone sw82g1 as well as sonicated reads from this subclone" CHROMOSOME_III assembly_tag annotation 12161647 12161649 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -This area is covered only by two subclones. The subclone from the Y75B8 library reads gtg whereas the suclone from Y79H2 reads gttgg. The sequence has been edited to the sequence given by the Y75B8 clone." CHROMOSOME_III assembly_tag annotation 12176971 12176988 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[x] OtherAdd a comment here -number of g's in this run is uncertain it has been edited to the maximum ie 18" CHROMOSOME_III assembly_tag annotation 12190160 12190310 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by sonicated reads of subclone sx15g5" CHROMOSOME_III assembly_tag annotation 12220037 12220049 . + . Note "First select a Feature -[X] Unsure[ ] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -This region of 13bp is covered only by single direction dye primers. There are two subclones covering this point. The region falls in the arm of an inverted repeat." CHROMOSOME_III assembly_tag annotation 12230758 12231649 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Tandem repeat region containing false join and also single clone regions. Repeat element is 11bp long. There is variation between some of the copies." CHROMOSOME_III assembly_tag annotation 12249116 12249147 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Clone Y75B8 has deleted these copies of the tandem repeat. It has been edited to the maximum number as shown by the overlapping clones H26P12 and Y79H2." CHROMOSOME_III assembly_tag annotation 12298226 12298228 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -The sequence for the overlapping cloneY79H2 reads cAg and not cGg. This looksto be a base variation between thesetwo clones." CHROMOSOME_III assembly_tag annotation 12304995 12305274 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only by the subclone qb19b1. Region is only covered with terminator chemistry. This is contained in the arm of an inverted repeat." CHROMOSOME_III assembly_tag annotation 12305590 12306054 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only by the subclone qb19a5.Subclone has been sequenced with terminator and primer chemistries." CHROMOSOME_III assembly_tag Clone 12311895 12311898 . + . Note "right end: Y79H2" CHROMOSOME_III assembly_tag annotation 12312673 12313776 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Region contains dispersed IR-2 inverted repeat similar to sequence U86947. The repeat is flanked by a tandem duplication of the sequence CAATT. This region contains some areas of single clone. The first arm of the inverted repeat has approximately 135bp missing which has been represented with the sequence from the second arm." CHROMOSOME_III assembly_tag annotation 12320744 12320922 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by reads from a sonication of subclone sx14b2." CHROMOSOME_III assembly_tag annotation 12325873 12326664 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence ATAG. The region contains a single clone." CHROMOSOME_III assembly_tag annotation 12337301 12338355 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -The tandem repeat unit is 31bp. The area also contains a single clone region." CHROMOSOME_III assembly_tag annotation 12339218 12339256 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion only contains sonicated reads from subclone sx09f1." CHROMOSOME_III assembly_tag annotation 12346570 12346596 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Region is covered by two subclones one of which has deleted out one copy of a tandem repeat at this point." CHROMOSOME_III assembly_tag annotation 12356843 12356880 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only by a single direction primer read. This region is in an arm of an inverted repeat." CHROMOSOME_III assembly_tag annotation 12356968 12356999 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region is covered only with a single clone, which lies in the arm of an inverted repeat. " CHROMOSOME_III assembly_tag annotation 12400755 12400888 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by sonicated reads from subclone sx12c2." CHROMOSOME_III assembly_tag annotation 12404219 12406525 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -This tandem repeat region contains a forced join and also single clone regions. The repeat elements are approximately 37bp long, and show variation between the copies." CHROMOSOME_III assembly_tag annotation 12411656 12411692 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region is covered only by a single clone. The subclone has been sequenced with both chemistries." CHROMOSOME_III assembly_tag Finished 12425687 12425692 . + . Note "Left: Y49E10" CHROMOSOME_III assembly_tag Clone 12425687 12425692 . + . Note "left end: Y49E10" CHROMOSOME_III assembly_tag Clone 12425687 12425692 . + . Note "left end: Y49E10" CHROMOSOME_III assembly_tag Finished 12425788 12425793 . + . Note "Right: Y75B8A" CHROMOSOME_III assembly_tag annotation 12434821 12434832 . - . Note "[ ] Tandem repeat \n[X] Single clone region \n[ ] Forced join \n[ ] Other \nComment\nRegion is covered only by a single clone.\nRegion consistent with the digest." CHROMOSOME_III assembly_tag Clone 12460266 12460271 . + . Note "right end: Y75B8" CHROMOSOME_III assembly_tag Clone 12461917 12461922 . + . Note "left end: Y111B2" CHROMOSOME_III assembly_tag annotation 12466678 12466685 . + . Note "[ ] Tandem repeat \n[X] Single clone region \n[ ] Forced join \n[ ] Other \nComment\nRegion covered by sonicated library of clone sr36a5." CHROMOSOME_III assembly_tag annotation 12474441 12474506 . + . Note "[ ] Tandem repeat \n[X] Single clone region \n[ ] Forced join \n[ ] Other \nComment\nRegion is covered only by one clone but is consistent with the digest." CHROMOSOME_III assembly_tag annotation 12481892 12481924 . + . Note "[ ] Tandem repeat \n[X] Single clone region \n[ ] Forced join \n[ ] Other \nComment\nSingle clone region containing reads from a sonication of clone sp26f9." CHROMOSOME_III assembly_tag Finished 12551172 12551177 . + . Note "Left: Y111B2A" CHROMOSOME_III assembly_tag Finished 12551271 12551276 . + . Note "Right: Y49E10" CHROMOSOME_III assembly_tag Clone 12551271 12551276 . + . Note "right end: Y49E10" CHROMOSOME_III assembly_tag Clone 12551271 12551276 . + . Note "right end: Y49E10" CHROMOSOME_III assembly_tag annotation 12552214 12552258 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - SIL of sp27c12 " CHROMOSOME_III assembly_tag annotation 12552214 12552258 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - SIL of sp27c12\n" CHROMOSOME_III assembly_tag annotation 12562486 12562610 . + . Note "First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - " CHROMOSOME_III assembly_tag annotation 12565575 12565662 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here - primers only here\n" CHROMOSOME_III assembly_tag annotation 12577250 12577251 . + . Note "First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - One read only has 1 T, edited to the majority of 3 reads which call 2 T's. " CHROMOSOME_III assembly_tag annotation 12621621 12621656 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here - \nsingle direction primers in inverted repeat\n" CHROMOSOME_III assembly_tag annotation 12661426 12661716 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - this region contains reads from SIL of sp15g11\n" CHROMOSOME_III assembly_tag Finished 12661894 12661897 . - . Note "Right: Y111B2A" CHROMOSOME_III assembly_tag annotation 12661898 12662023 . + . Note "First select a Feature -\n[ ] Unsure\n[ ] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - join made using repK data\n" CHROMOSOME_III assembly_tag annotation 12661899 12662024 . + . Note "First select a Feature -\n[ ] Unsure\n[ ] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - join made using repK data\n" CHROMOSOME_III assembly_tag annotation 12668442 12668604 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here - primer only over inverted repeat\n" CHROMOSOME_III assembly_tag annotation 12668446 12668446 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here - primers only here, unable to sequence terminators.\n" CHROMOSOME_III assembly_tag annotation 12668809 12668868 . + . Note "First select a Feature -\n[ ] Unsure\n[x] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[x] Other\nAdd a comment here - single direction primers only here\n" CHROMOSOME_III assembly_tag annotation 12729434 12729478 . + . Note "First select a Feature -\n[ ] Unsure\n[ ] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - join confirmed by inv. rpt\n" CHROMOSOME_III assembly_tag annotation 12737200 12738450 . + . Note "First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here - Repeat contains 156bp single clone region. so95e8 SIL confirms join but does not cover the single clone region. Edited to the remainder of the repeat." CHROMOSOME_III assembly_tag annotation 12774576 12774613 . + . Note "First select a Feature -\n[ ] Unsure\n[ ] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - area contained within IR-2 rpt, bridged by so82b5 and sp12c12\n" CHROMOSOME_III assembly_tag annotation 12774626 12774658 . + . Note "First select a Feature -\n[ ] Unsure\n[ ] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - area contained within IR-2 rpt, bridged by so82b5 and sp12c12\n" CHROMOSOME_III assembly_tag annotation 12779213 12779231 . + . Note "First select a Feature -\n[ ] Unsure\n[ ] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - join confirmed by repH sequence\n" CHROMOSOME_III assembly_tag annotation 12791463 12791471 . + . Note "First select a Feature -\n[ ] Unsure\n[ ] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[x] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here - join confirmed by repJ\n" CHROMOSOME_III assembly_tag Clone 12808768 12808773 . + . Note "left end: ZC482" CHROMOSOME_III assembly_tag Finished 12808768 12808773 . + . Note "Left: ZC482" CHROMOSOME_III assembly_tag Finished 12808868 12808873 . + . Note "Right: Y111B2A" CHROMOSOME_III assembly_tag Finished 12844962 12844965 . + . Note "Left: BE10" CHROMOSOME_III assembly_tag Clone 12845064 12845069 . + . Note "right end: ZC482" CHROMOSOME_III assembly_tag Clone 12845064 12845069 . + . Note "right end: ZC482" CHROMOSOME_III assembly_tag Finished 12845064 12845069 . + . Note "Right: ZC482" CHROMOSOME_III assembly_tag Finished 12875194 12875197 . + . Note "Left: Y37D8A" CHROMOSOME_III assembly_tag Finished 12875294 12875297 . + . Note "Right: BE10" CHROMOSOME_III assembly_tag Clone 12875294 12875297 . + . Note "right end: BE10" CHROMOSOME_III assembly_tag Clone 12875294 12875297 . + . Note "right end: BE10" CHROMOSOME_III assembly_tag annotation 12931394 12932167 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence GTACT." CHROMOSOME_III assembly_tag annotation 12961486 12962276 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence ACATT." CHROMOSOME_III assembly_tag annotation 12981536 12982364 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. This copy of the repeat does not have a flanking duplicated sequence.This copy also contains a region which is covered only by one subclone." CHROMOSOME_III assembly_tag annotation 12991147 12991644 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. In this copy the arms are shorter by approximately bp also there is no flanking duplication of sequence. The sequence which gives rise to the shortened version of this repeat is derived from subclones from two yac clones." CHROMOSOME_III assembly_tag annotation 13006315 13006317 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[X] Other\nAdd a comment here -\nThe overlapping clone Y111B2 reads GGG at this point." CHROMOSOME_III assembly_tag Finished 13007830 13007835 . + . Note "Left: Y39E4A" CHROMOSOME_III assembly_tag Clone 13007830 13007835 . + . Note "left end: Y39E4A" CHROMOSOME_III assembly_tag Clone 13007830 13007835 . - . Note "left end: Y39E4" CHROMOSOME_III assembly_tag Finished 13007930 13007935 . + . Note "Right: Y37D8A" CHROMOSOME_III assembly_tag Clone 13033935 13033938 . + . Note "left end: Beginning of ZK1010" CHROMOSOME_III assembly_tag Clone 13033935 13033938 . + . Note "right end: Y39E4A" CHROMOSOME_III assembly_tag Finished 13033935 13033938 . + . Note "Left: ZK1010" CHROMOSOME_III assembly_tag Clone 13033935 13033938 . + . Note "left end: ZK1010" CHROMOSOME_III assembly_tag Finished 13034035 13034038 . + . Note "Right: Y39E4A" CHROMOSOME_III assembly_tag annotation 13057699 13057701 . + . Note "all stolen reads say 9 A's, but all \nother reads say 8 A's so edited to\nthe maximum number." CHROMOSOME_III assembly_tag annotation 13057764 13057766 . + . Note "all stolen reads say 12 G's, but all\nother reads say 13 G's so edited to\nthe maximum." CHROMOSOME_III assembly_tag Finished 13067345 13067348 . + . Note "Left: F14F7" CHROMOSOME_III assembly_tag Clone 13067345 13067348 . + . Note "left end: F14F7" CHROMOSOME_III assembly_tag Clone 13067345 13067348 . + . Note "left end: Beginning of F14F7" CHROMOSOME_III assembly_tag Finished 13067442 13067445 . + . Note "Right: ZK1010" CHROMOSOME_III assembly_tag Clone 13067797 13067800 . + . Note "right end: ZK1010" CHROMOSOME_III assembly_tag annotation 13068618 13068695 . + . CHROMOSOME_III assembly_tag annotation 13068696 13068757 . + . CHROMOSOME_III assembly_tag annotation 13070994 13071004 . + . Note "reads 277,880 and 1061 (single clone) have 3 A's and 8 T's. The rest have 4 A's and 7 T's.\n\nEdited to 4 A's and 7 T's." CHROMOSOME_III assembly_tag annotation 13071044 13071046 . + . Note "reads 277, 880 and 1061 (a single clone) have ATG but all other reads have AGG.\n\nEdited to AGG" CHROMOSOME_III assembly_tag annotation 13090142 13090797 . + . Note "tandem repeat of length 1.1kb. \nA typical repeat element is \nTACCGCCCGCTACCACCGC (a 19-mer)" CHROMOSOME_III assembly_tag Clone 13092709 13092712 . + . Note "left end: F54F12" CHROMOSOME_III assembly_tag Clone 13092709 13092712 . + . Note "left end: F54F12 clone left" CHROMOSOME_III assembly_tag Finished 13092709 13092712 . + . Note "Left: " CHROMOSOME_III assembly_tag Finished 13092809 13092812 . + . Note "Right: F14F7" CHROMOSOME_III assembly_tag Clone 13103990 13103993 . + . Note "right end: F14F7 clone right" CHROMOSOME_III assembly_tag annotation 13123964 13123983 . - . CHROMOSOME_III assembly_tag Finished 13125320 13125323 . + . Note "Left: Y39E4B" CHROMOSOME_III assembly_tag Clone 13125420 13125423 . + . Note "right end: F54F12" CHROMOSOME_III assembly_tag Finished 13125420 13125423 . + . Note "Right: " CHROMOSOME_III assembly_tag Clone 13125420 13125423 . - . Note "right end: F54F12 clone right" CHROMOSOME_III assembly_tag annotation 13132654 13144686 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region contains a tandem repeat each copy is approximately 58bp and there is variation amongst the copies. Region also contains forced joins and single clones." CHROMOSOME_III assembly_tag annotation 13173034 13173100 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region covered only from subcloned reads taken from a pcr product produced from yac dna." CHROMOSOME_III assembly_tag annotation 13173405 13174885 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Single clone region covered by subclone qa58a3. This subclone has been sonicated." CHROMOSOME_III assembly_tag annotation 13203443 13203512 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[X] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region only covered by subclone sl39b10. This clone has been sequenced using both chemistries. Lies in the arm of an inverted repeat." CHROMOSOME_III assembly_tag annotation 13205132 13205142 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by sonications of subclone sl35a10." CHROMOSOME_III assembly_tag annotation 13205722 13205722 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[ ] Single clone region\n[ ] Forced join\n[X] Other\nAdd a comment here -\nSubclone from overlaping project Y37D8 reads AG." CHROMOSOME_III assembly_tag annotation 13205741 13206531 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence TAATC. Region also contains single clone section." CHROMOSOME_III assembly_tag Clone 13223956 13223961 . - . Note "right end: Y37D8" CHROMOSOME_III assembly_tag annotation 13251318 13251382 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only with sonicated reads from subclone sm20b2." CHROMOSOME_III assembly_tag annotation 13251641 13252430 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Dispersed IR-2 inverted repeat similar to sequence U86947. Repeat is flanked by a tandem duplication of the sequence TATAA." CHROMOSOME_III assembly_tag annotation 13253655 13253658 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nSingle clone region containing sonicated reads from subclone sm19h10." CHROMOSOME_III assembly_tag annotation 13256427 13256871 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion only contains sonicated reads from subclone sm27e7" CHROMOSOME_III assembly_tag annotation 13258212 13258235 . + . Note "First select a Feature -\n[ ] Unsure\n[X] Misc_feature\nThen select the text for the note(s) -\n[ ] Tandem repeat\n[X] Single clone region\n[ ] Forced join\n[ ] Other\nAdd a comment here -\nRegion covered only by sonicated reads from subclone sm30c7." CHROMOSOME_III assembly_tag annotation 13260878 13261478 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Some subclones show a deletion at this point. A digest on subclone sm23c6 showed two bands on the gel one of which was ~600bp smaller than the other. Region of sequence contains single direction primers. Subclone sm32e11 has totoally deleted this region which contains an inverted repeat." CHROMOSOME_III assembly_tag annotation 13279216 13279229 . + . Note "First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Yac sequence shows 14 c's but the reads from the underlying clone F09D11 all say 13. It has been edited to the consensus of the yac." CHROMOSOME_III assembly_tag Finished 13280896 13280901 . + . Note "Left: Y43F4A" CHROMOSOME_III assembly_tag Clone 13280896 13280901 . - . Note "left end: Y43F4A" CHROMOSOME_III assembly_tag Clone 13280896 13280901 . - . Note "left end: Y43F4" CHROMOSOME_III assembly_tag Finished 13281008 13281012 . + . Note "Right: Y39E4B" CHROMOSOME_III assembly_tag Clone 13304720 13304723 . + . Note "right end: Y43F4A" CHROMOSOME_III assembly_tag Clone 13304720 13304723 . - . Note "left end: F56A8" CHROMOSOME_III assembly_tag Finished 13304720 13304723 . - . Note "Left: F56A8" CHROMOSOME_II